Anthidium mormonum

Cresson, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records715

Data sources8

Biological traits2

DNA specimens24

eDNA detections0

Sources8 archives

Databases and archives Anthidium mormonum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF715 records

DNA & barcodingBOLD24 specimens

Genome at a glanceGoaT · TreeOfSex2n = 32

01Narrative

Anthidium mormonum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.38 mm

Tongue length4.79 mm

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium mormonum has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

40Cmostly conserved

310Tmostly conserved

343Tmostly conserved

367Cvariable

586Cmostly conserved

625Amostly conserved

631Amostly conserved

AATACTATATATAATTTTTGCTTTATGATCAGGTATAATCGGATCTTCAATAAGAATAATTATTCGGATAGAATTAAGAACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes13

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium utahensesame genus8.2%Anthidium placitumsame genus8.7%Anthidium jocosumsame genus9.1%Anthidium tenuifloraesame genus9.4%Anthidium formosumsame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthidium mormonum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records16–322n range32median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 161×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type715 records

Wild obs. + sensor14

Museum / vouchered701

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 4

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 5≤1 km 6≤10 km 101>10 km 5

117 georeferenced · 584 without coordinates

Open the institutions mapphysical evidence701

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	226
Wuzhou, CN	120
	88
Champaign, US	88
Oregon State Arthropod Collectionlocation not on record	74
University of Alabamalocation not on record	22
US	11
San Diego, US	10
Colorado State Universitylocation not on record	9
Awka, NG	8
Weber State University, Bird and Mammal Collectionlocation not on record	8
Provo, US	7
Cambridge, US	5
University of Central Floridalocation not on record	4
Universidad Católica de Manizaleslocation not on record	4
La Jolla, US	2
Budapest, HU	2
UFPRlocation not on record	2
Roberts Creek, CA	2
WSUClocation not on record	2
Vancouver, CA	1
ASUlocation not on record	1
University of California, Riverside, Entomology Research Museumlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Santa Cruz, US	1

25 institutions · 699 of 701 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)