Aneugmenus temporalis

(Thomson, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aneugmenus

At a glance

Occurrence records261

Data sources6

Biological traits0

DNA specimens36

eDNA detections37

Sources6 archives

Databases and archives Aneugmenus temporalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF261 records

Environmental DNA2 datasets · 7 countries37 detections

DNA & barcodingBOLD36 specimens

01Narrative

Aneugmenus temporalis is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door C. G. Thomson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneugmenus temporalis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections37

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

85Gmostly conserved

ATTATATTTTTTTTTTGGAATTTGATCAGGAATATTAGGATTATCATTTAGTATACTAATTCGTTCAGAATTAGGAATACCAGGGTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes3

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aneugmenus padisame genus6.6%Aneugmenus coronatussame genus7.8%Aneugmenus fuerstenbergensissame genus7.8%Aneugmenus flavipessame genus8.6%Aneugmenus oertzenisame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type261 records

Wild obs. + sensor125

Museum / vouchered136

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 40≤1 km 35≤10 km 39

114 georeferenced · 11 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 15≤1 km 14≤10 km 43

72 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	25
BioFokuslocation not on record	14
ZMAAlocation not on record	11
Provincia di Livornolocation not on record	6
NHMOlocation not on record	6
neflocation not on record	5
Tromsø, NO	3
ZSMlocation not on record	3
Zürich, CH	1
DFlocation not on record	1
Helsinki, FI	1
South Kensington, GB	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

13 institutions · 78 of 136 vouchered records shown · 58 without an institution code

09Environmental DNA37 detections

Where the DNA of Aneugmenus temporalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys2

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.0–17.4

Seasonal swing summer↔winter26.2 °C

Max temp (day)17.5 °C 16.8–21.0

Min temp (night)10.8 °C 9.60–13.8

Precipitation78.1 mm/mo 70.5–97.9

Air humidity58.6 % 58.5–63.5

Moisture balance-35.3 mm/mo -41.8–12.3

Vapour deficit678 Pa 624–804

Wind speed2.50 m/s 2.40–4.40

Cloud cover46.7 % 34.6–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)