Aneugmenus fuerstenbergensis

(Konow, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aneugmenus

At a glance

Occurrence records149

Data sources6

Biological traits0

DNA specimens33

eDNA detections33

Sources6 archives

Databases and archives Aneugmenus fuerstenbergensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF149 records

Environmental DNA1 datasets · 4 countries33 detections

DNA & barcodingBOLD33 specimens

01Narrative

Aneugmenus fuerstenbergensis is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1885 door Konow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneugmenus fuerstenbergensis has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections33

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Tvariable

4Amostly conserved

5Tmostly conserved

6Amostly conserved

41Cmostly conserved

79Gvariable

130Cvariable

184Tmostly conserved

310Amostly conserved

430Tvariable

526Tvariable

TTTATATTTTTTTTTTGGAATTTGATCAGGTATATTAGGACTATCATTTAGAATATTAATTCGTTCAGAATTAGGAATGCCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes12

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aneugmenus temporalissame genus7.8%Aneugmenus padisame genus7.8%Aneugmenus coronatussame genus8.0%Aneugmenus flavipessame genus8.4%Aneugmenus oertzenisame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor67

Museum / vouchered82

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 27≤1 km 16≤10 km 17>10 km 1

61 georeferenced · 6 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 9≤1 km 11≤10 km 23

43 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	31
neflocation not on record	7
BioFokuslocation not on record	5
NHMOlocation not on record	2
ZMAAlocation not on record	1
Tilburg, NL	1

6 institutions · 47 of 82 vouchered records shown · 35 without an institution code

09Environmental DNA33 detections

Where the DNA of Aneugmenus fuerstenbergensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 8.70–15.2

Seasonal swing summer↔winter25.5 °C

Max temp (day)17.2 °C 11.9–18.6

Min temp (night)10.2 °C 5.60–11.6

Precipitation66.2 mm/mo 42.1–77.1

Air humidity57.8 % 56.3–58.9

Moisture balance-50.3 mm/mo -56.7–-36.1

Vapour deficit678 Pa 473–738

Wind speed2.50 m/s 2.40–4.20

Cloud cover44.5 % 42.7–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)