Aneugmenus flavipes

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aneugmenus

At a glance

Occurrence records513

Data sources5

Biological traits0

DNA specimens90

eDNA detections89

Sources5 archives

Databases and archives Aneugmenus flavipes's data was compiled from.

GBIFGlobal Biodiversity Information Facility513 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics90 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF513 records

Environmental DNA1 datasets · 2 countries89 detections

DNA & barcodingBOLD90 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding90 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneugmenus flavipes has left across the world's sequence archives.

At a glance

DNA specimens90

BINs1

Marker genes1

eDNA detections89

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus87 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

38Tmostly conserved

43Tvariable

139Avariable

184Amostly conserved

190Amostly conserved

543Tmostly conserved

578Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Tmostly conserved

620Tmostly conserved

621Cmostly conserved

622Amostly conserved

625Tmostly conserved

628Amostly conserved

630Gmostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

636Cmostly conserved

638Amostly conserved

642Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

649Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

654Tmostly conserved

655Amostly conserved

AACATTATATTTTTTTTTTGGAATCTGATCAGGTATATTAGGTTTATCATTTAGTATATTAATTCGTTCAGAACTAGGTATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes13

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aneugmenus oertzenisame genus8.1%Aneugmenus fuerstenbergensissame genus8.4%Aneugmenus padisame genus8.5%Aneugmenus temporalissame genus8.6%Aneugmenus coronatussame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type513 records

Wild obs. + sensor5

Museum / vouchered508

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 57≤10 km 157

214 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	214
OSUClocation not on record	75
University of Guelphlocation not on record	71
University of Guelph, Centre for Biodiversity Genomicslocation not on record	37
University of Central Floridalocation not on record	30
Toronto, CA	19
Chicago, US	14
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 461 of 508 vouchered records shown · 47 without an institution code

09Environmental DNA89 detections

Where the DNA of Aneugmenus flavipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map2 countries0

ForestMixed HabitatGrasslandMixed habitat1. Forest & WoodlandMeadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 10.8–17.0

Seasonal swing summer↔winter26.3 °C

Max temp (day)17.4 °C 14.1–21.7

Min temp (night)11.1 °C 8.20–15.0

Precipitation107 mm/mo 92.9–142

Air humidity59.9 % 58.0–62.8

Moisture balance-14.7 mm/mo -47.7–26.0

Vapour deficit670 Pa 486–807

Wind speed2.80 m/s 2.40–5.60

Cloud cover46.2 % 41.9–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)