Aneugmenus coronatus

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aneugmenus

At a glance

Occurrence records232

Data sources6

Biological traits0

DNA specimens47

eDNA detections45

Sources6 archives

Databases and archives Aneugmenus coronatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF232 records

Environmental DNA3 datasets · 8 countries45 detections

DNA & barcodingBOLD47 specimens

01Narrative

Aneugmenus coronatus is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneugmenus coronatus has left across the world's sequence archives.

At a glance

DNA specimens47

BINs1

Marker genes1

eDNA detections45

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

2Amostly conserved

313Amostly conserved

340Tmostly conserved

AACATTATATTTTTTTTTTGGAATTTGATCAGGAATATTAGGTTTATCATTTAGTATATTAATTCGTTCAGAACTAGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes3

BIN1

Most divergent pair0.30%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aneugmenus padisame genus5.9%Aneugmenus temporalissame genus7.8%Aneugmenus fuerstenbergensissame genus8.0%Aneugmenus oertzenisame genus8.1%Aneugmenus flavipessame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type232 records

Wild obs. + sensor148

Museum / vouchered84

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 65≤1 km 39≤10 km 16

120 georeferenced · 28 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 17≤1 km 11≤10 km 21

49 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BioFokuslocation not on record	9
NHMOlocation not on record	8
ZSMlocation not on record	7
Provincia di Livornolocation not on record	7
South Kensington, GB	5
Tilburg, NL	3
Stockholm, SE	2
Bavarian State Collection of Zoologylocation not on record	2
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
Oulu, FI	1
Philadelphia, US	1
Helsinki, FI	1
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1

14 institutions · 49 of 84 vouchered records shown · 35 without an institution code

09Environmental DNA45 detections

Where the DNA of Aneugmenus coronatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys3

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map8 countries0

Urban1. Forest & Woodland | 1.4. Temperate Forest14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.6–18.2

Seasonal swing summer↔winter19.1 °C

Max temp (day)18.2 °C 17.0–23.1

Min temp (night)10.6 °C 8.20–14.2

Precipitation75.4 mm/mo 54.5–158

Air humidity59.9 % 56.6–64.2

Moisture balance-37.8 mm/mo -63.1–55.9

Vapour deficit635 Pa 584–884

Wind speed2.20 m/s 1.60–4.00

Cloud cover43.5 % 32.7–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)