Aneugmenus padi

(Linnaeus, 1760) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Aneugmenus

At a glance

Occurrence records820

Data sources8

Biological traits0

DNA specimens39

eDNA detections38

Sources8 archives

Databases and archives Aneugmenus padi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF820 records

Environmental DNA1 datasets · 14 countries38 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceTreeOfSex2n = 16

01Narrative

Aneugmenus padi is a species of sawfly (order Hymenoptera, family Tenthredinidae).Biolib

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneugmenus padi has left across the world's sequence archives.

At a glance

DNA specimens39

BINs3

Marker genes1

eDNA detections38

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

9Amostly conserved

38Cmostly conserved

43Amostly conserved

55Amostly conserved

59Tmostly conserved

64Cmostly conserved

74Tmostly conserved

76Amostly conserved

79Tmostly conserved

91Tmostly conserved

99Gmostly conserved

100Tmostly conserved

181Amostly conserved

184Amostly conserved

212Cmostly conserved

271Cmostly conserved

343Tmostly conserved

352Cmostly conserved

373Gmostly conserved

385Tmostly conserved

386Amostly conserved

412Amostly conserved

418Cmostly conserved

625Gmostly conserved

628Amostly conserved

AACATTATATTTTTTTTTTGGAATTTGATCAGGAATACTAGGATTATCATTTAGAATATTAATCCGTTCAGAATTAGGTATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs3

Most divergent pair0.46%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aneugmenus coronatussame genus5.9%Aneugmenus temporalissame genus6.6%Aneugmenus fuerstenbergensissame genus7.8%Aneugmenus flavipessame genus8.5%Aneugmenus oertzenisame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Aneugmenus padi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×TreeOfSex · invert

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

08Occurrence & distribution

Record type820 records

Wild obs. + sensor568

Museum / vouchered252

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 304≤1 km 114≤10 km 115>10 km 1

534 georeferenced · 34 without coordinates

Open the mapobservation + sensor568

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 22≤1 km 31≤10 km 145>10 km 1

199 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence252

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	130
Provincia di Livornolocation not on record	17
ZSMlocation not on record	13
BioFokuslocation not on record	12
Tilburg, NL	9
Natural History Museum Rotterdamlocation not on record	7
DFFW2018location not on record	5
Zürich, CH	4
NCMGlocation not on record	4
MZLUlocation not on record	4
Oulu, FI	2
Helsinki, FI	2
DFlocation not on record	2
South Kensington, GB	2
SLU Artdatabankenlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Stockholm, SE	1
OSUClocation not on record	1
Vancouver, CA	1
Tromsø, NO	1
Natural History Museum, Londonlocation not on record	1

21 institutions · 221 of 252 vouchered records shown · 31 without an institution code

09Environmental DNA38 detections

Where the DNA of Aneugmenus padi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map14 countries0

Moist subalpine meadowsapiniere1. Forest & Woodland|1.1. Boreal ForestBlueberry field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.3 °C 10.9–17.0

Seasonal swing summer↔winter17.6 °C

Max temp (day)17.6 °C 15.3–21.0

Min temp (night)8.30 °C 5.80–12.6

Precipitation77.2 mm/mo 32.7–127

Air humidity58.4 % 54.1–61.6

Moisture balance-38.3 mm/mo -115–17.6

Vapour deficit630 Pa 537–808

Wind speed2.60 m/s 1.40–4.40

Cloud cover37.9 % 31.5–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)