Andrena tridens

Robertson, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records855

Data sources6

Biological traits0

DNA specimens37

eDNA detections45

Sources6 archives

Databases and archives Andrena tridens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility855 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF855 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD37 specimens

01Narrative

Andrena tridens is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Robertson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena tridens has left across the world's sequence archives.

At a glance

DNA specimens37

BINs3

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

1Amostly conserved

16Cvariable

28Amostly conserved

40Tmostly conserved

41Gmostly conserved

43Tmostly conserved

46Gvariable

49Amostly conserved

50Cmostly conserved

52Tmostly conserved

58Tmostly conserved

61Cmostly conserved

88Cvariable

91Amostly conserved

97Cvariable

99Amostly conserved

112Tmostly conserved

115Tvariable

119Tmostly conserved

121Cmostly conserved

122Amostly conserved

130Tmostly conserved

133Tmostly conserved

137Gmostly conserved

139Tmostly conserved

142Tmostly conserved

143Avariable

154Tmostly conserved

166Amostly conserved

172Tmostly conserved

178Tmostly conserved

184Amostly conserved

187Tmostly conserved

193Tmostly conserved

199Tmostly conserved

205Amostly conserved

208Amostly conserved

212Cmostly conserved

214Tvariable

220Amostly conserved

223Amostly conserved

226Tmostly conserved

229Amostly conserved

241Tmostly conserved

259Tmostly conserved

265Tvariable

268Amostly conserved

271Tvariable

275Tmostly conserved

280Tmostly conserved

290Cmostly conserved

292Amostly conserved

304Amostly conserved

328Amostly conserved

334Amostly conserved

335Gmostly conserved

346Amostly conserved

347Tmostly conserved

355Amostly conserved

359Amostly conserved

360Amostly conserved

361Tmostly conserved

363Tmostly conserved

364Tmostly conserved

370Amostly conserved

380Gmostly conserved

385Tmostly conserved

386Tmostly conserved

400Cvariable

403Avariable

406Cvariable

409Tmostly conserved

416Gmostly conserved

421Amostly conserved

424Cmostly conserved

427Tmostly conserved

442Cmostly conserved

445Cmostly conserved

458Cmostly conserved

472Tmostly conserved

475Amostly conserved

479Tmostly conserved

487Tmostly conserved

494Cmostly conserved

496Tmostly conserved

499Amostly conserved

500Tmostly conserved

505Cmostly conserved

510Gmostly conserved

517Amostly conserved

544Tmostly conserved

550Avariable

557Cmostly conserved

568Cvariable

573Cmostly conserved

578Tmostly conserved

580Amostly conserved

592Amostly conserved

613Tmostly conserved

619Amostly conserved

628Tvariable

640Tvariable

641Tvariable

646Tvariable

AATACTATATTTTATCTTCGCAATATGAGCAGGTATAATTGGTGCGTCACTTAGATTTATCATTCGTATAGAATTAAGAAATCCAGGCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes3

BINs3

Most divergent pair14.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena astragalisame genus6.7%Andrena geraniisame genus7.3%Andrena nigrocaeruleasame genus7.8%Andrena caeruleasame genus7.8%Andrena lawrenceisame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type855 records

Wild obs. + sensor38

Museum / vouchered817

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 19≤1 km 8≤10 km 2>10 km 3

32 georeferenced · 6 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 1≤1 km 18≤10 km 65>10 km 5

89 georeferenced · 728 without coordinates

Open the institutions mapphysical evidence817

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	313
	225
Champaign, US	62
University Park, US	47
Wuzhou, CN	26
New Haven, US	21
LULlocation not on record	18
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
WIlocation not on record	11
Cambridge, US	10
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	10
Cornell University Insect Collectionlocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Beltsville, US	6
White River Junction, US	6
UNHClocation not on record	5
OSUClocation not on record	3
New Haven, US	3
Centre for Biodiversity Genomicslocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
Blacksburg, US	1
University of Guelphlocation not on record	1
York University, Packer Collectionlocation not on record	1
Anchorage, US	1
North Carolina State University Insect Museumlocation not on record	1

25 institutions · 807 of 817 vouchered records shown · 10 without an institution code

09Environmental DNA45 detections

Where the DNA of Andrena tridens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

open mixed forestMixed habitatsandy bluffdry graminoid herbaceousdry forb herbaceousVillage, Park. Grass/Sedge; Taraxacum sp., A…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 4.30–15.6

Seasonal swing summer↔winter29.3 °C

Max temp (day)16.4 °C 9.00–20.1

Min temp (night)6.20 °C 0.8–12.3

Precipitation89.8 mm/mo 58.6–124

Air humidity61.1 % 53.0–62.5

Moisture balance2.10 mm/mo

Vapour deficit611 Pa 400–761

Wind speed2.90 m/s

Cloud cover51.5 % 39.4–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)