Andrena geranii

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records752

Data sources7

Biological traits3

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Andrena geranii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility752 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF752 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

The geranium miner bee (Andrena geranii) is a species of miner bee in the family Andrenidae. Another common name for this species is the geranium andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.92 cm

Intertegular distance (ITD)2.48 mm

Wing length6.2 mm

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena geranii has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

5Cmostly conserved

13Tmostly conserved

34Amostly conserved

646Tmostly conserved

AATACTATATTTTATTTTTGCAATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes5

BINs2

Most divergent pair7.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena lawrenceisame genus5.5%Andrena tridenssame genus7.3%Andrena astragalisame genus7.5%Andrena nigrocaeruleasame genus7.6%Andrena caeruleasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type752 records

Wild obs. + sensor59

Museum / vouchered693

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 38≤1 km 18>10 km 2

58 georeferenced · 1 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 16≤1 km 39≤10 km 220>10 km 18

293 georeferenced · 400 without coordinates

Open the institutions mapphysical evidence693

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	192
	76
Cornell University Insect Collectionlocation not on record	63
White River Junction, US	63
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	54
US	46
WIlocation not on record	42
St. Paul, US	32
OSUClocation not on record	30
Cambridge, US	16
Colorado State Universitylocation not on record	10
UNHClocation not on record	9
Chicago, US	4
University Park, US	4
University of Central Floridalocation not on record	2
PCYUlocation not on record	1
Toronto, CA	1
Royal Saskatchewan Museumlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

19 institutions · 647 of 693 vouchered records shown · 46 without an institution code

09Environmental DNA24 detections

Where the DNA of Andrena geranii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

Mixed HabitatGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 12.5–21.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.6 °C 16.6–24.7

Min temp (night)13.5 °C 8.20–18.0

Precipitation94.3 mm/mo 75.4–130

Air humidity57.9 % 55.3–59.0

Moisture balance-47.0 mm/mo -71.6–-4.60

Vapour deficit756 Pa 627–1,054

Wind speed3.80 m/s 2.60–6.20

Cloud cover42.7 % 38.0–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)