Andrena nigrocaerulea

Cockerell, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 165

Data sources7

Biological traits1

DNA specimens44

eDNA detections28

Sources7 archives

Databases and archives Andrena nigrocaerulea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 165 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 165 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD44 specimens

01Narrative

The black and blue miner bee (Andrena nigrocaerulea) is a species of miner bee in the family Andrenidae. Another common name for this species is the blue-and-black andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.95 mm

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena nigrocaerulea has left across the world's sequence archives.

At a glance

DNA specimens44

BINs3

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

43Tvariable

58Cvariable

61Tvariable

97Cvariable

118Tvariable

121Tvariable

130Cvariable

145Tmostly conserved

172Cvariable

199Cvariable

217Tvariable

266Cvariable

271Tvariable

281Tmostly conserved

337Tvariable

386Tvariable

508Avariable

520Cvariable

532Cvariable

548Tvariable

550Amostly conserved

559Gvariable

568Cvariable

616Tmostly conserved

AATATTATATTTTATTTTCGCTATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes6

BINs3

Most divergent pair14.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena caeruleasame genus7.4%Andrena geraniisame genus7.6%Andrena tridenssame genus7.8%Andrena nigrihirtasame genus8.2%Andrena lawrenceisame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 165 records

Wild obs. + sensor45

Museum / vouchered1 120

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 24≤1 km 5≤10 km 4>10 km 4

37 georeferenced · 8 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 32≤1 km 18≤10 km 218>10 km 3

271 georeferenced · 849 without coordinates

Open the institutions mapphysical evidence1 120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	518
Champaign, US	146
	75
Weber State University, Bird and Mammal Collectionlocation not on record	69
WSUClocation not on record	52
US	40
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	38
Nelson, CA	25
Santa Cruz, US	23
Santa Barbara Museum of Natural Historylocation not on record	22
University of California, Davislocation not on record	19
Vancouver, CA	15
Roberts Creek, CA	12
WIlocation not on record	11
Cambridge, US	10
BBSLlocation not on record	9
Wuzhou, CN	4
OSUClocation not on record	4
La Jolla, US	2
Toronto, CA	2
USU/EMUS/AEIlocation not on record	2
US	1
Essig Museum of Entomologylocation not on record	1

23 institutions · 1 100 of 1 120 vouchered records shown · 20 without an institution code

09Environmental DNA28 detections

Where the DNA of Andrena nigrocaerulea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 8.00–16.2

Seasonal swing summer↔winter22.6 °C

Max temp (day)18.1 °C 12.5–23.0

Min temp (night)5.90 °C 1.40–9.20

Precipitation44.2 mm/mo 17.2–86.1

Air humidity52.4 % 47.3–60.7

Moisture balance-91.3 mm/mo -137–2.60

Vapour deficit678 Pa 460–930

Wind speed3.20 m/s 1.90–3.80

Cloud cover38.9 % 33.4–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena nigrocaerulea

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 165 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 165 records