Andrena lawrencei

Viereck & Cockerell, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records286

Data sources7

Biological traits0

DNA specimens28

eDNA detections32

Sources7 archives

Databases and archives Andrena lawrencei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF286 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD28 specimens

01Narrative

The Lawrence's miner bee (Andrena lawrencei) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena lawrencei has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

1Tvariable

28Avariable

34Avariable

82Cvariable

88Gvariable

136Cmostly conserved

184Gvariable

262Amostly conserved

295Amostly conserved

304Amostly conserved

316Avariable

340Cmostly conserved

433Amostly conserved

458Tmostly conserved

511Avariable

556Gmostly conserved

568Cmostly conserved

625Gvariable

628Amostly conserved

TATACTATATTTTATTTTTGCAATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAACCCAGGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes11

BIN1

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena geraniisame genus5.5%Andrena astragalisame genus7.5%Andrena caeruleasame genus7.6%Andrena tridenssame genus7.9%Andrena nigrocaeruleasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type286 records

Museum / vouchered286

Range

Area of Occupancy AOO272 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 14≤1 km 1≤10 km 41

56 georeferenced · 230 without coordinates

Open the institutions mapphysical evidence286

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	197
WSUClocation not on record	38
Weber State University, Bird and Mammal Collectionlocation not on record	33
Champaign, US	7
WIlocation not on record	5
Vancouver, CA	4
	2

7 institutions · 286 of 286 vouchered records shown

09Environmental DNA32 detections

Where the DNA of Andrena lawrencei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C 3.20–11.6

Seasonal swing summer↔winter22.6 °C

Max temp (day)9.90 °C 8.20–17.4

Min temp (night)-1.60 °C -4.10–5.10

Precipitation30.0 mm/mo 20.6–68.4

Air humidity53.4 % 49.4–54.0

Moisture balance-47.8 mm/mo -91.8–-33.2

Vapour deficit392 Pa 377–670

Wind speed3.00 m/s 2.50–3.60

Cloud cover41.7 % 37.2–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)