Andrena astragali

Viereck & Cockerell, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records472

Data sources7

Biological traits1

DNA specimens71

eDNA detections70

Sources7 archives

Databases and archives Andrena astragali's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF472 records

Environmental DNA1 datasets · 2 countries70 detections

DNA & barcodingBOLD71 specimens

01Narrative

The death camas miner bee (Andrena astragali), is a species of miner bee in the family Andrenidae. Another common name for this species is death camas andrena. It is found in North America. It specialises in feeding on the highly poisonous Toxicoscordion venenosum and is possibly the only bee that can tolerate its toxins. Death camas andrena, Andrena astragali

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.95 mm

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena astragali has left across the world's sequence archives.

At a glance

DNA specimens71

BINs1

Marker genes1

eDNA detections70

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus71 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

367Amostly conserved

ACTATACTTTATTTTTGCAATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAATCCAGGAAAATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes8

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena tridenssame genus6.7%Andrena geraniisame genus7.5%Andrena caeruleasame genus7.5%Andrena lawrenceisame genus7.5%Andrena erigeniaesame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type472 records

Wild obs. + sensor150

Museum / vouchered322

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 81≤1 km 19≤10 km 4>10 km 20

124 georeferenced · 26 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 2≤1 km 15≤10 km 22>10 km 9

48 georeferenced · 274 without coordinates

Open the institutions mapphysical evidence322

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	224
Champaign, US	18
Santa Cruz, US	14
US	12
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
WSUClocation not on record	7
Cambridge, US	6
WIlocation not on record	5
Weber State University, Bird and Mammal Collectionlocation not on record	5
Colorado State Universitylocation not on record	4
OSUClocation not on record	3
	3
Vancouver, CA	1
Santa Barbara Museum of Natural Historylocation not on record	1
Roberts Creek, CA	1
Washington, US	1
Essig Museum of Entomologylocation not on record	1

17 institutions · 318 of 322 vouchered records shown · 4 without an institution code

09Environmental DNA70 detections

Where the DNA of Andrena astragali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 11.2–13.2

Seasonal swing summer↔winter25.1 °C

Max temp (day)18.5 °C 17.4–20.2

Min temp (night)4.70 °C 4.30–9.10

Precipitation45.4 mm/mo 45.4–83.1

Air humidity53.8 % 51.9–58.6

Moisture balance-91.1 mm/mo -91.1–-44.9

Vapour deficit649 Pa 574–666

Wind speed2.30 m/s 2.20–2.90

Cloud cover41.6 % 39.2–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)