Andrena erigeniae

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records14 398

Data sources7

Biological traits3

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Andrena erigeniae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF14 398 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Andrena erigeniae, the spring beauty miner bee or spring beauty andrena is a species of miner bee native to North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.82 cm

Intertegular distance (ITD)2.2 mm

Wing length7 mm

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena erigeniae has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

88Amostly conserved

94Gvariable

206Tvariable

316Gmostly conserved

AATATTATACTTCATCTTTGCAATATGAGCAGGAATAATTGGTGCATCACTAAGATTTATTATTCGTATAGAACTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena tridenssame genus8.2%Andrena astragalisame genus9.0%Andrena caeruleasame genus9.6%Andrena nigrihirtasame genus9.9%Andrena ruficrussame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 398 records

Wild obs. + sensor1 004

Museum / vouchered13 376

Other18

Range

Area of Occupancy AOO4 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 431≤1 km 303≤10 km 27>10 km 59

820 georeferenced · 184 without coordinates

Open the mapobservation + sensor1 004

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 87≤1 km 124≤10 km 600>10 km 19

830 georeferenced · 12 546 without coordinates

Open the institutions mapphysical evidence13 376

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	11 932
Champaign, US	654
Lexington, US	130
Beltsville, US	113
	101
White River Junction, US	58
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	36
Cambridge, US	35
LULlocation not on record	25
OSUClocation not on record	25
WIlocation not on record	22
New Haven, US	22
St. Paul, US	17
North Carolina State University Insect Museumlocation not on record	16
Cleveland Museum of Natural History, OH (CLEV)location not on record	15
UNHClocation not on record	14
University Park, US	9
Cornell University Insect Collectionlocation not on record	8
Chicago, US	7
Mississippi State, US	6
Colorado State Universitylocation not on record	3
Vermont Center for Ecostudieslocation not on record	3
VTFPRlocation not on record	2
SUNY ESFlocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
EL PASO, US	1
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	1
Philadelphia, US	1
Blacksburg, US	1
FWSlocation not on record	1
SOVTlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
WSUClocation not on record	1

33 institutions · 13 265 of 13 376 vouchered records shown · 111 without an institution code

09Environmental DNA10 detections

Where the DNA of Andrena erigeniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 9.30–18.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.2 °C 13.7–23.7

Min temp (night)8.20 °C 5.40–13.5

Precipitation92.8 mm/mo 73.5–118

Air humidity58.3 % 54.6–61.2

Moisture balance-11.0 mm/mo -53.8–-1.60

Vapour deficit695 Pa 464–873

Wind speed3.30 m/s 2.60–3.80

Cloud cover44.4 % 42.5–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena erigeniae

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type14 398 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 398 records