Andrena piperi

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 066

Data sources6

Biological traits2

DNA specimens17

eDNA detections0

Sources6 archives

Databases and archives Andrena piperi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 066 records↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 066 records

DNA & barcodingBOLD17 specimens

01Narrative

The Piper's miner bee (Andrena piperi) is a species of miner bee in the family Andrenidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)1.42 mm

Tongue length1.53 mm

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena piperi has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

1Tmostly conserved

5Tmostly conserved

10Tmostly conserved

13Tmostly conserved

22Tmostly conserved

26Tmostly conserved

34Amostly conserved

35Amostly conserved

46Amostly conserved

64Cmostly conserved

79Amostly conserved

118Cmostly conserved

124Cmostly conserved

130Cmostly conserved

133Tmostly conserved

136Tmostly conserved

142Tmostly conserved

151Tmostly conserved

163Amostly conserved

172Tmostly conserved

187Tmostly conserved

193Cmostly conserved

197Tmostly conserved

199Amostly conserved

202Tmostly conserved

206Cmostly conserved

211Gmostly conserved

212Tmostly conserved

220Amostly conserved

238Tmostly conserved

247Cmostly conserved

259Tmostly conserved

263Cmostly conserved

277Amostly conserved

280Cmostly conserved

281Cmostly conserved

283Tmostly conserved

285Tmostly conserved

287Cmostly conserved

299Gmostly conserved

304Cmostly conserved

316Gmostly conserved

319Cmostly conserved

322Tmostly conserved

334Tmostly conserved

335Amostly conserved

337Tmostly conserved

343Cmostly conserved

346Cmostly conserved

352Tmostly conserved

355Tmostly conserved

358Cmostly conserved

370Tmostly conserved

373Gmostly conserved

379Cmostly conserved

394Cmostly conserved

403Tmostly conserved

416Gmostly conserved

418Tmostly conserved

421Cmostly conserved

427Cmostly conserved

433Tmostly conserved

445Cmostly conserved

514Tmostly conserved

523Tmostly conserved

529Tmostly conserved

530Gmostly conserved

536Tmostly conserved

541Gmostly conserved

544Cmostly conserved

547Tmostly conserved

550Gmostly conserved

556Cmostly conserved

559Amostly conserved

565Cmostly conserved

574Tmostly conserved

578Cmostly conserved

589Cmostly conserved

595Tmostly conserved

610Cmostly conserved

616Cmostly conserved

622Amostly conserved

625Amostly conserved

631Gmostly conserved

646Tmostly conserved

TATATTATATTTTATATTCGCTATATGATCAGGAATAATTGGAGCATCATTAAGATTTATTATCCGAATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs2

Most divergent pair12.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena candidiformissame genus10.5%Andrena ziziaesame genus11.7%Andrena melanochroasame genus11.9%Andrena illinoiensissame genus12.0%Andrena chlorogastersame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 066 records

Wild obs. + sensor2

Museum / vouchered1 697

Other367

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 17≤1 km 21≤10 km 459>10 km 2

499 georeferenced · 1 198 without coordinates

Open the institutions mapphysical evidence1 697

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	934
Champaign, US	277
WSUClocation not on record	192
Wuzhou, CN	107
	69
University of Alabamalocation not on record	31
Weber State University, Bird and Mammal Collectionlocation not on record	22
OSUClocation not on record	15
University of California, Davislocation not on record	14
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	7
Essig Museum of Entomologylocation not on record	6
Cambridge, US	5
La Jolla, US	3
US	2
University of Central Floridalocation not on record	2
Provo, US	1

16 institutions · 1 687 of 1 697 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena piperi

At a glance

Sources6 archives

Size & morphology2

At a glance

Record type2 066 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Record type2 066 records