Andrena chlorogaster

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 230

Data sources6

Biological traits1

DNA specimens21

eDNA detections0

Sources6 archives

Databases and archives Andrena chlorogaster's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 230 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 230 records

DNA & barcodingBOLD21 specimens

01Narrative

The green-bellied miner bee (Andrena chlorogaster) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.24 mm

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena chlorogaster has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 91 variable positions, in barcode order

1Gvariable

5Tvariable

10Cmostly conserved

13Cmostly conserved

16Tmostly conserved

31Tmostly conserved

37Gmostly conserved

61Cmostly conserved

64Tmostly conserved

67Tmostly conserved

74Cmostly conserved

76Gmostly conserved

79Tmostly conserved

97Cmostly conserved

103Tvariable

106Cmostly conserved

121Tmostly conserved

124Tmostly conserved

130Cmostly conserved

136Cmostly conserved

157Cmostly conserved

163Tmostly conserved

172Cmostly conserved

178Cvariable

187Cmostly conserved

190Avariable

193Cmostly conserved

197Cmostly conserved

199Tmostly conserved

202Amostly conserved

205Tmostly conserved

211Amostly conserved

220Tmostly conserved

223Cvariable

232Amostly conserved

235Cmostly conserved

238Amostly conserved

247Tmostly conserved

250Tmostly conserved

262Amostly conserved

263Tmostly conserved

265Avariable

271Cmostly conserved

277Cmostly conserved

280Tmostly conserved

281Tmostly conserved

283Amostly conserved

286Amostly conserved

287Tmostly conserved

304Cmostly conserved

305Cmostly conserved

316Amostly conserved

328Cmostly conserved

335Gmostly conserved

340Tmostly conserved

346Cmostly conserved

352Cmostly conserved

358Tmostly conserved

364Cmostly conserved

385Tmostly conserved

394Tmostly conserved

433Amostly conserved

457Cmostly conserved

458Cmostly conserved

463Cmostly conserved

481Amostly conserved

499Amostly conserved

500Tmostly conserved

505Cmostly conserved

514Tmostly conserved

517Tmostly conserved

523Cmostly conserved

529Amostly conserved

530Amostly conserved

535Tmostly conserved

536Cmostly conserved

541Amostly conserved

544Tmostly conserved

547Amostly conserved

550Tmostly conserved

556Tmostly conserved

559Cvariable

565Amostly conserved

571Tmostly conserved

574Amostly conserved

592Gvariable

596Cmostly conserved

628Tvariable

631Gmostly conserved

646Cvariable

658Cvariable

GATATTATACTTCATTTTCGCTATATGATCTGGAATGATTGGAGCATCATTAAGATTTATCATTCGTATAGAACTGAGTAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes6

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena melanochroasame genus11.7%Andrena ziziaesame genus11.9%Andrena piperisame genus12.0%Andrena candidiformissame genus12.2%Andrena pandosasame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 230 records

Museum / vouchered983

Other247

Range

Area of Occupancy AOO872 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 27≤1 km 18≤10 km 239

284 georeferenced · 699 without coordinates

Open the institutions mapphysical evidence983

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	467
Champaign, US	221
Wuzhou, CN	142
Weber State University, Bird and Mammal Collectionlocation not on record	49
	23
Essig Museum of Entomologylocation not on record	20
University of California, Davislocation not on record	14
Santa Cruz, US	14
WSUClocation not on record	13
US	5
WIlocation not on record	3
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	3
University of Alabamalocation not on record	2

13 institutions · 976 of 983 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena chlorogaster

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 230 records

Range

Museum / Voucheredphysical evidence

Holding institutions6 of 13 geolocated

Record type1 230 records