Andrena ziziae

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 488

Data sources7

Biological traits1

DNA specimens12

eDNA detections1

Sources7 archives

Databases and archives Andrena ziziae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 488 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Andrena ziziae, the golden alexanders miner bee, is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.7 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena ziziae has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

1Gvariable

14Amostly conserved

15Tmostly conserved

16Amostly conserved

17Tmostly conserved

34Amostly conserved

50Cmostly conserved

64Cmostly conserved

74Cmostly conserved

79Tmostly conserved

82Cmostly conserved

97Cmostly conserved

112Tmostly conserved

115Cvariable

118Tmostly conserved

121Cmostly conserved

124Cmostly conserved

130Cmostly conserved

133Tmostly conserved

136Cmostly conserved

142Tmostly conserved

154Cmostly conserved

157Tmostly conserved

187Tmostly conserved

193Cmostly conserved

197Cmostly conserved

199Tmostly conserved

205Cmostly conserved

206Cmostly conserved

212Cmostly conserved

217Tmostly conserved

223Tmostly conserved

232Cmostly conserved

241Gmostly conserved

247Tmostly conserved

271Cmostly conserved

277Cmostly conserved

280Tmostly conserved

286Tmostly conserved

287Cmostly conserved

294Tmostly conserved

299Amostly conserved

302Tmostly conserved

303Tmostly conserved

305Tmostly conserved

316Cmostly conserved

319Amostly conserved

322Cmostly conserved

334Tmostly conserved

335Gmostly conserved

337Tmostly conserved

343Tmostly conserved

346Amostly conserved

347Tmostly conserved

349Amostly conserved

355Amostly conserved

357Amostly conserved

359Amostly conserved

370Tmostly conserved

385Cmostly conserved

386Tmostly conserved

400Amostly conserved

403Cmostly conserved

406Cmostly conserved

409Amostly conserved

433Tmostly conserved

439Amostly conserved

448Cmostly conserved

479Amostly conserved

490Tmostly conserved

500Tmostly conserved

514Cmostly conserved

523Tmostly conserved

533Tmostly conserved

536Tmostly conserved

539Tmostly conserved

544Tmostly conserved

548Cmostly conserved

556Amostly conserved

578Tmostly conserved

586Amostly conserved

595Cmostly conserved

596Cmostly conserved

634Cmostly conserved

641Tmostly conserved

646Cmostly conserved

GATACTATATTTTATATTTGCTATATGAGCAGGAATAATTGGAGCTTCACTAAGATTTATTATCCGTATAGAACTAAGTAACCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BINs2

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena personatasame genus6.6%Andrena microchlorasame genus11.4%Andrena illinoiensissame genus11.6%Andrena candidiformissame genus11.6%Andrena nigraesame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 488 records

Wild obs. + sensor43

Museum / vouchered2 445

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 27≤1 km 12>10 km 2

41 georeferenced · 2 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 19≤1 km 205≤10 km 399>10 km 6

629 georeferenced · 1 816 without coordinates

Open the institutions mapphysical evidence2 445

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	1 175
Champaign, US	746
St. Paul, US	145
WIlocation not on record	95
	91
White River Junction, US	38
US	28
Cambridge, US	22
Decorah, US	20
OSUClocation not on record	19
Washington, US	8
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
New Haven, US	6
Saint John, CA	6
Lexington, US	5
LULlocation not on record	3
Chicago, US	3
UNHClocation not on record	2
Philadelphia, US	1
Mississippi State, US	1
University of Minnesota Insect Collectionlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

22 institutions · 2 422 of 2 445 vouchered records shown · 23 without an institution code

09Environmental DNA1 detections

Where the DNA of Andrena ziziae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 17.1–17.1

Seasonal swing summer↔winter22.2 °C

Max temp (day)21.6 °C

Min temp (night)12.4 °C

Precipitation134 mm/mo

Air humidity62.2 %

Moisture balance-13.9 mm/mo

Vapour deficit735 Pa

Wind speed3.90 m/s

Cloud cover35.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena ziziae

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 488 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 488 records