Andrena microchlora

Cockerell, 1922 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records769

Data sources7

Biological traits0

DNA specimens43

eDNA detections50

Sources7 archives

Databases and archives Andrena microchlora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility769 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF769 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD43 specimens

01Narrative

The small green miner bee (Andrena microchlora) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena microchlora has left across the world's sequence archives.

At a glance

DNA specimens43

BINs3

Marker genes1

eDNA detections50

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

31Amostly conserved

34Amostly conserved

394Tmostly conserved

457Tvariable

499Cvariable

616Tmostly conserved

625Gmostly conserved

628Avariable

AATACTATACTTCATATTCGCAATATGATCAGGAATAATTGGAGCTTCATTAAGATTTATTATTCGAATAGAATTAAGTAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes21

BINs3

Most divergent pair14.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena luridilomasame genus11.1%Andrena gamskruckisame genus11.7%Andrena lunarissame genus12.3%Andrena caneaesame genus12.3%Andrena igraecasame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type769 records

Museum / vouchered729

Other40

Range

Area of Occupancy AOO656 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 57≤1 km 1≤10 km 241>10 km 21

320 georeferenced · 409 without coordinates

Open the institutions mapphysical evidence729

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	196
WSUClocation not on record	146
Champaign, US	129
Weber State University, Bird and Mammal Collectionlocation not on record	124
Wuzhou, CN	41
US	29
Colorado State Universitylocation not on record	21
Vancouver, CA	15
WIlocation not on record	14
	6
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
Washington, US	1
Universidad Católica de Manizaleslocation not on record	1

13 institutions · 729 of 729 vouchered records shown

09Environmental DNA50 detections

Where the DNA of Andrena microchlora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C 4.00–12.3

Seasonal swing summer↔winter22.6 °C

Max temp (day)14.6 °C 8.20–18.3

Min temp (night)2.00 °C -1.60–5.90

Precipitation41.3 mm/mo 26.7–83.5

Air humidity53.1 % 51.9–56.6

Moisture balance-48.1 mm/mo -92.2–-31.6

Vapour deficit539 Pa 377–681

Wind speed3.00 m/s 2.30–3.90

Cloud cover41.2 % 37.4–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)