Andrena illinoiensis

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 309

Data sources6

Biological traits1

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Andrena illinoiensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 309 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 309 records

DNA & barcodingBOLD5 specimens

01Narrative

The tufted miner bee (Andrena illinoiensis) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.26 mm

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena illinoiensis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes1

BIN1

Where individuals differ — all 18 variable positions, in barcode order

25Avariable

28Avariable

118Cvariable

130Cmostly conserved

142Tmostly conserved

184Amostly conserved

202Cmostly conserved

208Cmostly conserved

232Tmostly conserved

235Cmostly conserved

256Gmostly conserved

505Cmostly conserved

548Cmostly conserved

568Tmostly conserved

578Cmostly conserved

628Gmostly conserved

646Tvariable

649Avariable

AATACTATATTTCATCTTCGCCATATGAGCAGGAATAATTGGTGCCTCCTTAAGATTTATTATTCGTATAGAATTAAGTAACCCAGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena nigraesame genus9.0%Andrena melanochroasame genus9.7%Andrena candidiformissame genus11.1%Andrena ziziaesame genus11.6%Andrena piperisame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 309 records

Wild obs. + sensor2

Museum / vouchered2 303

Other4

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 5≤1 km 176≤10 km 618>10 km 62

861 georeferenced · 1 442 without coordinates

Open the institutions mapphysical evidence2 303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	1 137
Champaign, US	551
Beltsville, US	176
Universidad Católica de Manizaleslocation not on record	126
	68
University of Nebraska State Museumlocation not on record	60
US	41
UNHClocation not on record	30
Albuquerque, US	18
Cambridge, US	13
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
Colorado State Universitylocation not on record	11
WIlocation not on record	9
OSUClocation not on record	9
WSUClocation not on record	9
Mississippi State, US	1
Cornell University Insect Collectionlocation not on record	1
University of Alabamalocation not on record	1

18 institutions · 2 273 of 2 303 vouchered records shown · 30 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena illinoiensis

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type2 309 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Record type2 309 records