Andrena melanochroa

Cockerell, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records596

Data sources7

Biological traits3

DNA specimens18

eDNA detections10

Sources7 archives

Databases and archives Andrena melanochroa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility596 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF596 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD18 specimens

01Narrative

Andrena melanochroa The rose miner bee (Andrena melanochroa) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.62 cm

Intertegular distance (ITD)1.29 mm

Wing length4.7 mm

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena melanochroa has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

1Avariable

4Avariable

5Tmostly conserved

13Cmostly conserved

16Tmostly conserved

19Tmostly conserved

25Avariable

29Gmostly conserved

34Avariable

38Amostly conserved

40Cmostly conserved

43Amostly conserved

49Amostly conserved

50Tmostly conserved

58Tmostly conserved

61Tmostly conserved

67Tmostly conserved

79Tvariable

82Cmostly conserved

90Gmostly conserved

97Cmostly conserved

115Cmostly conserved

121Amostly conserved

122Gmostly conserved

124Cmostly conserved

130Cmostly conserved

139Tmostly conserved

142Cmostly conserved

145Tmostly conserved

160Avariable

166Amostly conserved

178Cmostly conserved

181Avariable

184Gvariable

187Cmostly conserved

190Tvariable

193Cmostly conserved

197Cmostly conserved

199Cmostly conserved

202Cmostly conserved

205Tvariable

208Cmostly conserved

217Tmostly conserved

223Tmostly conserved

229Avariable

232Cmostly conserved

247Cmostly conserved

250Cmostly conserved

265Amostly conserved

266Cmostly conserved

271Amostly conserved

290Tmostly conserved

299Amostly conserved

304Tvariable

322Amostly conserved

325Tmostly conserved

355Tmostly conserved

361Amostly conserved

363Amostly conserved

364Tmostly conserved

394Tmostly conserved

409Tmostly conserved

433Gvariable

442Tmostly conserved

448Tmostly conserved

458Tmostly conserved

496Amostly conserved

500Tvariable

505Cmostly conserved

514Tmostly conserved

520Cmostly conserved

523Cmostly conserved

526Amostly conserved

532Cmostly conserved

535Tmostly conserved

536Tvariable

539Cmostly conserved

544Cvariable

557Cmostly conserved

559Tmostly conserved

571Cmostly conserved

574Amostly conserved

595Tmostly conserved

596Cmostly conserved

619Amostly conserved

628Amostly conserved

631Tvariable

634Cvariable

637Amostly conserved

641Tmostly conserved

653Tmostly conserved

658Tmostly conserved

AATATTATACTTCATTTTTGCTATATGAGCAGGAATAATCGGAGCATCATTAAGATTTATTATTCGTATAGAATTAAGTAACCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes8

BINs3

Most divergent pair12.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena nigraesame genus7.3%Andrena illinoiensissame genus9.7%Andrena candidiformissame genus11.6%Andrena chlorogastersame genus11.7%Andrena ziziaesame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type596 records

Wild obs. + sensor1

Museum / vouchered568

Other27

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 31≤1 km 36≤10 km 64>10 km 10

141 georeferenced · 427 without coordinates

Open the institutions mapphysical evidence568

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	194
	45
Champaign, US	43
Cornell University Insect Collectionlocation not on record	42
White River Junction, US	37
Wuzhou, CN	33
WIlocation not on record	29
Cambridge, US	24
Weber State University, Bird and Mammal Collectionlocation not on record	19
US	13
Toronto, CA	12
WSUClocation not on record	10
Santa Cruz, US	7
Mississippi State, US	6
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
Saint John, CA	5
St. Paul, US	5
Toronto, CA	4
University Park, US	3
Universidad Católica de Manizaleslocation not on record	3
UNHClocation not on record	3
Royal Saskatchewan Museumlocation not on record	2
North Carolina State University Insect Museumlocation not on record	2
Essig Museum of Entomologylocation not on record	2
SUNY ESFlocation not on record	2
Lexington, US	2
Washington, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

28 institutions · 555 of 568 vouchered records shown · 13 without an institution code

09Environmental DNA10 detections

Where the DNA of Andrena melanochroa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

ForestGrasslandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 11.4–18.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.1 °C 14.3–23.9

Min temp (night)9.70 °C 7.70–13.7

Precipitation87.2 mm/mo 77.0–99.7

Air humidity57.3 % 55.2–60.6

Moisture balance-44.2 mm/mo

Vapour deficit687 Pa 491–903

Wind speed3.80 m/s

Cloud cover44.8 % 40.8–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)