Andrena nigrae

Robertson, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 639

Data sources7

Biological traits1

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Andrena nigrae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 639 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Andrena nigrae, sometimes called the black miner bee is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.9 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena nigrae has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

19Tmostly conserved

22Tvariable

130Cvariable

146Amostly conserved

184Amostly conserved

202Cmostly conserved

250Cvariable

316Gvariable

433Avariable

496Gmostly conserved

500Cmostly conserved

526Cvariable

622Amostly conserved

625Avariable

631Avariable

641Tmostly conserved

652Tvariable

AATATTATATTTCATTTTTGCTATATGAGCAGGAATAATTGGAGCCTCATTAAGATTTATTATCCGTATAGAATTAAGAAACCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BIN1

Most divergent pair1.8%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena melanochroasame genus7.3%Andrena illinoiensissame genus9.0%Andrena ziziaesame genus11.7%Andrena personatasame genus12.2%Andrena piperisame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 639 records

Wild obs. + sensor2

Museum / vouchered1 636

Other1

Range

Area of Occupancy AOO820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 273≤10 km 834>10 km 23

1 130 georeferenced · 506 without coordinates

Open the institutions mapphysical evidence1 636

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	782
Wuzhou, CN	280
Universidad Católica de Manizaleslocation not on record	220
US	107
Cornell University Insect Collectionlocation not on record	68
	35
WIlocation not on record	29
University of Nebraska State Museumlocation not on record	22
North Carolina State University Insect Museumlocation not on record	19
Beltsville, US	18
College Station, US	10
White River Junction, US	10
WSUClocation not on record	8
Mississippi State, US	7
Colorado State Universitylocation not on record	5
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
Royal Saskatchewan Museumlocation not on record	4
LULlocation not on record	3
Cambridge, US	2
UNHClocation not on record	1
University Park, US	1

21 institutions · 1 635 of 1 636 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Andrena nigrae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

agricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 9.20–16.4

Seasonal swing summer↔winter26.3 °C

Max temp (day)18.2 °C 16.5–22.7

Min temp (night)5.40 °C 2.10–11.0

Precipitation69.9 mm/mo 58.6–81.1

Air humidity53.1 % 51.4–55.6

Moisture balance-66.3 mm/mo -69.2–-42.7

Vapour deficit623 Pa 560–849

Wind speed3.90 m/s 2.70–4.30

Cloud cover41.4 % 35.6–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena nigrae

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 639 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 639 records