Andrena alleghaniensis

Viereck, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records725

Data sources7

Biological traits1

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Andrena alleghaniensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility725 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF725 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

The Appalachian miner bee (Andrena alleghaniensis) is a species of miner bee in the family Andrenidae. Another common name for this species is Alleghany andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.2 mm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena alleghaniensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P608 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 3 variable positions, in barcode order

355Tmostly conserved

374Avariable

583Gvariable

AGCCTCACTAAGATTCATCATCCGAATAGAATTAAGCAATCCAGGAAGATGAATTAACAATGATCAAATTTATAATTCAATTGTAACATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena pallidifoveasame genus11.7%Andrena miegiellasame genus12.0%Andrena lathyrisame genus12.3%Andrena feroxsame genus12.3%Andrena moriosame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type725 records

Wild obs. + sensor98

Museum / vouchered624

Other3

Range

Area of Occupancy AOO1 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 50≤1 km 19≤10 km 2>10 km 21

92 georeferenced · 6 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 10≤1 km 77≤10 km 59>10 km 1

147 georeferenced · 477 without coordinates

Open the institutions mapphysical evidence624

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	133
US	83
	80
WIlocation not on record	77
White River Junction, US	59
New Haven, US	28
Champaign, US	23
East Lansing, US	19
Cambridge, US	9
St. Paul, US	9
FWSlocation not on record	7
University of Central Floridalocation not on record	6
UNHClocation not on record	5
Wuzhou, CN	4
OSUClocation not on record	4
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	3
LULlocation not on record	3
Saint John, CA	2
Beltsville, US	2
SUNY ESFlocation not on record	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
WSUClocation not on record	2
Blacksburg, US	1
VTFPRlocation not on record	1
Washington, US	1
Philadelphia, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

27 institutions · 567 of 624 vouchered records shown · 57 without an institution code

09Environmental DNA5 detections

Where the DNA of Andrena alleghaniensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Forestwoodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 9.80–15.5

Seasonal swing summer↔winter27.7 °C

Max temp (day)16.6 °C 14.4–18.9

Min temp (night)7.10 °C 5.80–12.5

Precipitation95.2 mm/mo 88.5–107

Air humidity60.3 % 56.8–62.5

Moisture balance-21.5 mm/mo -55.9–4.90

Vapour deficit585 Pa 481–693

Wind speed3.90 m/s 2.90–4.80

Cloud cover48.9 % 44.0–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)