Andrena lathyri
Alfken, 1899 · speciesAt a glance
Occurrence records3 852
Data sources5
Biological traits2
DNA specimens34
eDNA detections20
Sources5 archives
Databases and archives Andrena lathyri's data was compiled from.
On this page4 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements1 literature sources2 traits
Occurrence & distributionGBIF3 852 records
Environmental DNA1 datasets · 6 countries20 detections
DNA & barcodingBOLD34 specimens
02Traits & measurements
SourcesBeeMorph
Size & morphology2
Intertegular distance (ITD)2.5 mm
Tongue length2.5 mm
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena lathyri has left across the world's sequence archives.
At a glance
DNA specimens34
BINs3
Marker genes2
eDNA detections20
Countries8
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus13 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.
Where individuals differ — all 121 variable positions, in barcode order
7Gmostly conserved
16Tmostly conserved
22Tmostly conserved
25Gmostly conserved
40Tmostly conserved
64Tmostly conserved
78Gmostly conserved
88Cmostly conserved
103Cmostly conserved
127Amostly conserved
163Amostly conserved
166Gmostly conserved
232Cmostly conserved
250Cmostly conserved
266Tmostly conserved
277Gmostly conserved
298Tmostly conserved
302Gmostly conserved
364Tmostly conserved
367Cmostly conserved
373Gmostly conserved
400Amostly conserved
406Cmostly conserved
409Tmostly conserved
433Tmostly conserved
442Cmostly conserved
471Amostly conserved
472Tmostly conserved
473Amostly conserved
474Tmostly conserved
475Cmostly conserved
476Tmostly conserved
477Cmostly conserved
480Tmostly conserved
481Amostly conserved
482Amostly conserved
485Tmostly conserved
487Tmostly conserved
488Gmostly conserved
490Cmostly conserved
491Cmostly conserved
492Amostly conserved
494Amostly conserved
495Tmostly conserved
496Amostly conserved
498Cmostly conserved
499Tmostly conserved
500Cmostly conserved
502Amostly conserved
503Tmostly conserved
504Tmostly conserved
505Cmostly conserved
506Cmostly conserved
507Cmostly conserved
510Gmostly conserved
511Amostly conserved
512Tmostly conserved
513Cmostly conserved
514Cmostly conserved
515Gmostly conserved
517Amostly conserved
518Tmostly conserved
520Tmostly conserved
522Tmostly conserved
523Cmostly conserved
526Amostly conserved
528Cmostly conserved
530Amostly conserved
532Cmostly conserved
535Tmostly conserved
536Cmostly conserved
539Tmostly conserved
541Amostly conserved
542Amostly conserved
543Tmostly conserved
544Cmostly conserved
545Tmostly conserved
546Cmostly conserved
547Tmostly conserved
549Tmostly conserved
550Tmostly conserved
551Cmostly conserved
552Cmostly conserved
553Amostly conserved
554Gmostly conserved
556Tmostly conserved
557Cmostly conserved
558Tmostly conserved
559Amostly conserved
561Cmostly conserved
562Tmostly conserved
564Gmostly conserved
566Gmostly conserved
567Cmostly conserved
568Amostly conserved
570Tmostly conserved
571Tmostly conserved
573Cmostly conserved
575Amostly conserved
581Cmostly conserved
582Tmostly conserved
584Tmostly conserved
585Cmostly conserved
586Amostly conserved
587Gmostly conserved
588Amostly conserved
589Tmostly conserved
590Cmostly conserved
591Gmostly conserved
592Amostly conserved
593Amostly conserved
594Amostly conserved
595Tmostly conserved
596Cmostly conserved
597Tmostly conserved
598Amostly conserved
601Cmostly conserved
607Cmostly conserved
616Tmostly conserved
628Amostly conserved
+1 more variable positions not shown
AATGTTGTACTTCATTTTCGCTATGTGGGCAGGAATAGTTGGAGCCTCACTAAGATTCATTATTCGAATAGAATTAAGAAATCCAGGCAA …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)3.1%
Haplotypes3
BINs2
Most divergent pair0.30%
Europe
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P16S
animal barcoderibosomal
08Occurrence & distribution
Record type3 852 records
Wild obs. + sensor1 718
Museum / vouchered2 122
Other12
Origin
Native563
Range
Area of Occupancy AOO5 696 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 707≤1 km 340≤10 km 621>10 km 1
1 669 georeferenced · 49 without coordinates
Open the mapobservation + sensor1 718
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy26% within 1 km
≤100 m 190≤1 km 319≤10 km 1 391>10 km 32
1 932 georeferenced · 190 without coordinates
Open the institutions mapphysical evidence2 122
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions16 of 43 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| SLU Artdatabankenlocation not on record | 352 |
| ULglocation not on record | 231 |
| Helsinki, FI | 159 |
| Bern, CH | 146 |
| Zürich, CH | 113 |
| Provincia di Livornolocation not on record | 112 |
| Musee d'Histoire Naturallelocation not on record | 97 |
| NMOKlocation not on record | 88 |
| Bonn, DE | 65 |
| Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record | 55 |
| Paro, BT | 27 |
| BioFokuslocation not on record | 24 |
| Museum zu Allerheiligen Schaffhausenlocation not on record | 24 |
| Trondheim, NO | 21 |
| Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record | 20 |
| ZSMlocation not on record | 19 |
| Philadelphia, US | 19 |
| Dhaka, BD | 18 |
| PRAZlocation not on record | 16 |
| neflocation not on record | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| IENElocation not on record | 14 |
| Natuurpuntlocation not on record | 13 |
| Bavarian State Collection of Zoologylocation not on record | 10 |
| Geneva, CH | 9 |
| Gothenburg, SE | 8 |
| Frauenfeld, CH | 7 |
| MZLUlocation not on record | 6 |
| NHMOlocation not on record | 6 |
| Wuzhou, CN | 6 |
| Muzeum Górnośląskie w Bytomiulocation not on record | 5 |
| Mons, BE | 5 |
| Forschungsinstitut für biologischen Landbau Frick | Research Institute of Organic Agriculture Fricklocation not on record | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record | 3 |
| Metsähallituslocation not on record | 3 |
| 3 | |
| Fribourg, CH | 3 |
| Ghent, BE | 2 |
| PRUNlocation not on record | 2 |
| University of Florence, Department of Biologylocation not on record | 1 |
| MNHWlocation not on record | 1 |
| KZMlocation not on record | 1 |
43 institutions · 1 752 of 2 122 vouchered records shown · 370 without an institution code
09Environmental DNA20 detections
Where the DNA of Andrena lathyri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 10.5–18.6
Seasonal swing summer↔winter18.1 °C
Max temp (day)18.2 °C 13.7–22.7
Min temp (night)8.80 °C 5.60–13.0
Precipitation66.2 mm/mo 50.4–92.6
Air humidity58.8 % 57.4–59.9
Moisture balance-42.1 mm/mo -72.2–-22.2
Vapour deficit673 Pa 529–862
Wind speed3.20 m/s 1.70–3.50
Cloud cover38.5 % 31.7–42.6
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.