Andrena russula

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 420

Data sources6

Biological traits0

DNA specimens40

eDNA detections8

Sources6 archives

Databases and archives Andrena russula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 420 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 420 records

Environmental DNA1 datasets · 5 countries8 detections

DNA & barcodingBOLD40 specimens

01Narrative

Andrena russula is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1841 door Lepeletier.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena russula has left across the world's sequence archives.

At a glance

DNA specimens40

BINs7

Marker genes3

eDNA detections8

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

19Cvariable

25Amostly conserved

40Tmostly conserved

43Amostly conserved

50Cmostly conserved

58Cvariable

67Tmostly conserved

73Gvariable

91Tvariable

118Tmostly conserved

127Cvariable

130Cmostly conserved

136Cvariable

166Avariable

238Gvariable

247Tmostly conserved

256Amostly conserved

266Cvariable

268Amostly conserved

280Tvariable

290Cmostly conserved

293Avariable

316Gmostly conserved

325Tmostly conserved

337Tvariable

364Tvariable

376Amostly conserved

385Tmostly conserved

403Tvariable

409Cvariable

418Tmostly conserved

442Tvariable

478Cvariable

479Tmostly conserved

484Cmostly conserved

499Cmostly conserved

500Cvariable

511Amostly conserved

532Tvariable

533Tmostly conserved

536Cvariable

538Gvariable

539Cvariable

544Cvariable

547Tvariable

550Amostly conserved

556Tmostly conserved

581Tmostly conserved

589Tmostly conserved

595Tvariable

596Cvariable

601Cmostly conserved

607Cmostly conserved

616Cvariable

634Tvariable

637Tvariable

640Tmostly conserved

AATATTATACTTCATTTTCGCTATATGAGCAGGAATAATTGGAGCCTCACTAAGATTCATTATTCGTATAGAGTTAAGAAATCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes11

BINs6

Most divergent pair6.1%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena similissame genus1.5%Andrena antonellaesame genus4.0%Andrena intermediasame genus4.1%Andrena contractasame genus4.3%Andrena gelriaesame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type1 420 records

Wild obs. + sensor423

Museum / vouchered995

Other2

Origin

Native496

Range

Area of Occupancy AOO1 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 47≤1 km 36≤10 km 335

418 georeferenced · 5 without coordinates

Open the mapobservation + sensor423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 90≤1 km 151≤10 km 702>10 km 19

962 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence995

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	86
Zürich, CH	81
SLU Artdatabankenlocation not on record	71
Helsinki, FI	68
Musee d'Histoire Naturallelocation not on record	62
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	60
Paro, BT	57
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	55
Coimbra, PT	53
NHMOlocation not on record	42
Philadelphia, US	25
PRAZlocation not on record	16
Dhaka, BD	16
Geneva, CH	14
PRUNlocation not on record	13
Museum zu Allerheiligen Schaffhausenlocation not on record	8
Sion, CH	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Universität Zürich, Naturhistorisches Museumlocation not on record	4
Provincia di Livornolocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Frauenfeld, CH	3
IENElocation not on record	2
Winterthur, CH	2
Research Collection of Christophe Prazlocation not on record	2
ZMAAlocation not on record	2
University of Florence, Department of Biologylocation not on record	1
Metsähallituslocation not on record	1
Research Collection of T. Woodlocation not on record	1
Natural History Museum, Bernlocation not on record	1
Oberoesterreichisches Landesmuseum, Biologiezentrum, Linzlocation not on record	1

31 institutions · 766 of 995 vouchered records shown · 229 without an institution code

09Environmental DNA8 detections

Where the DNA of Andrena russula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 12.3–18.6

Seasonal swing summer↔winter19.9 °C

Max temp (day)21.1 °C 16.6–24.1

Min temp (night)8.20 °C 5.20–11.3

Precipitation36.3 mm/mo 17.1–100

Air humidity49.2 % 44.3–59.0

Moisture balance-140 mm/mo -150–-42.3

Vapour deficit846 Pa 668–1,082

Wind speed3.10 m/s 2.00–5.70

Cloud cover31.4 % 22.5–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena russula

At a glance

Sources6 archives

At a glance

Record type1 420 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 420 records