Andrena morio

Brullé, 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records488

Data sources6

Biological traits0

DNA specimens25

eDNA detections12

Sources6 archives

Databases and archives Andrena morio's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF488 records

Environmental DNA1 datasets · 7 countries12 detections

DNA & barcodingBOLD25 specimens

01Narrative

Andrena morio Brullé, 1832 è un insetto apoideo della famiglia Andrenidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena morio has left across the world's sequence archives.

At a glance

DNA specimens25

BINs7

Marker genes1

eDNA detections12

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

5Cmostly conserved

13Cmostly conserved

16Tmostly conserved

19Cmostly conserved

31Cmostly conserved

38Gmostly conserved

46Gmostly conserved

49Avariable

64Cvariable

130Cmostly conserved

136Cvariable

139Cmostly conserved

163Gmostly conserved

172Cmostly conserved

205Gmostly conserved

259Tmostly conserved

263Cmostly conserved

268Gmostly conserved

280Tvariable

304Tmostly conserved

313Gmostly conserved

335Gmostly conserved

359Gmostly conserved

364Cmostly conserved

373Amostly conserved

388Avariable

394Cmostly conserved

400Avariable

406Cmostly conserved

409Cmostly conserved

427Cvariable

445Tvariable

460Amostly conserved

475Tmostly conserved

502Tmostly conserved

505Tmostly conserved

523Cvariable

526Cvariable

538Gmostly conserved

544Tvariable

581Tmostly conserved

601Cmostly conserved

610Tmostly conserved

619Tmostly conserved

628Tmostly conserved

634Tvariable

643Avariable

646Cvariable

656Tmostly conserved

AATACTATACTTCATTTTCGCTATATGAGCCGGAATAGTTGGAGCGTCACTAAGATTTATTATCCGTATAGAATTAAGAAATCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes12

BINs6

Most divergent pair10.0%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena wataseisame genus8.2%Andrena albopunctatasame genus8.3%Andrena thoracicasame genus8.4%Andrena limatasame genus9.0%Andrena parathoracicasame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type488 records

Wild obs. + sensor214

Museum / vouchered216

Other58

Origin

Native22

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 53≤1 km 48≤10 km 29>10 km 12

142 georeferenced · 72 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 3≤1 km 50≤10 km 90>10 km 28

171 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	85
Wuzhou, CN	28
Coimbra, PT	22
Provincia di Livornolocation not on record	12
ZSMlocation not on record	8
	8
IMEDEAlocation not on record	5
NMOKlocation not on record	4
Philadelphia, US	3
Bavarian State Collection of Zoologylocation not on record	3
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Bonn, DE	3
UMONSlocation not on record	1
Helsinki, FI	1
Paris, FR	1
Adam Mickiewicz University in Poznańlocation not on record	1

16 institutions · 188 of 216 vouchered records shown · 28 without an institution code

09Environmental DNA12 detections

Where the DNA of Andrena morio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map7 countries0

Herbaceous dune vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 10.5–22.0

Seasonal swing summer↔winter17.3 °C

Max temp (day)20.8 °C 15.7–27.4

Min temp (night)10.6 °C 4.10–16.7

Precipitation34.7 mm/mo 13.7–72.2

Air humidity56.5 % 53.3–61.4

Moisture balance-94.2 mm/mo -152–-18.7

Vapour deficit782 Pa 584–1,209

Wind speed3.30 m/s 2.40–4.80

Cloud cover31.6 % 19.5–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)