Andrena limata

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records639

Data sources6

Biological traits0

DNA specimens33

eDNA detections2

Sources6 archives

Databases and archives Andrena limata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF639 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD33 specimens

01Narrative

Andrena limata is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena limata has left across the world's sequence archives.

At a glance

DNA specimens33

BINs5

Marker genes1

eDNA detections2

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

1Avariable

19Cmostly conserved

22Tmostly conserved

40Tvariable

64Tmostly conserved

67Tvariable

74Tmostly conserved

82Tmostly conserved

88Gvariable

118Tvariable

265Gmostly conserved

274Cmostly conserved

301Amostly conserved

367Cmostly conserved

373Cvariable

394Tvariable

397Cvariable

409Tvariable

412Avariable

421Cmostly conserved

463Tvariable

487Cvariable

496Avariable

502Avariable

523Cmostly conserved

532Tmostly conserved

548Tmostly conserved

595Tmostly conserved

596Cvariable

601Cvariable

607Avariable

613Tvariable

616Tvariable

619Tvariable

625Tvariable

628Tmostly conserved

634Tmostly conserved

640Tmostly conserved

641Cvariable

AATATTATACTTCATTTTCGCTATATGAGCAGGTATAATTGGAGCCTCACTAAGATTCATTATTCGTATAGAATTAAGAAATCCAGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes9

BINs5

Most divergent pair10.6%

AfricaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena thoracicasame genus1.7%Andrena parathoracicasame genus6.2%Andrena wataseisame genus6.5%Andrena albopunctatasame genus8.6%Andrena assimilissame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type639 records

Wild obs. + sensor33

Museum / vouchered441

Other165

Origin

Native66

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 7≤1 km 6≤10 km 19

32 georeferenced · 1 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 9≤1 km 142≤10 km 244>10 km 12

407 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence441

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	131
Zürich, CH	88
Wuzhou, CN	83
NMOKlocation not on record	22
Coimbra, PT	20
Philadelphia, US	12
Musee d'Histoire Naturallelocation not on record	9
Paro, BT	8
KZMlocation not on record	7
ZSMlocation not on record	6
Bern, CH	5
Museu Nacional de História Natural e da Ciêncialocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
ULglocation not on record	3
PRAZlocation not on record	2
PRUNlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Tel Aviv University, The Steinhardt Museum of Natural Historylocation not on record	1
OOLMlocation not on record	1
Private Collection of Thomas J. Woodlocation not on record	1
Private Collection of Ulrich Neumuellerlocation not on record	1
Geneva, CH	1
UMONSlocation not on record	1
	1

25 institutions · 417 of 441 vouchered records shown · 24 without an institution code

09Environmental DNA2 detections

Where the DNA of Andrena limata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 12.3–14.8

Seasonal swing summer↔winter17.2 °C

Max temp (day)16.7 °C 16.6–16.7

Min temp (night)9.40 °C 7.00–11.8

Precipitation41.8 mm/mo 38.2–45.4

Air humidity53.5 % 50.0–57.1

Moisture balance-75.0 mm/mo -86.8–-63.2

Vapour deficit721 Pa 720–723

Wind speed2.80 m/s 2.20–3.30

Cloud cover41.7 % 39.7–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)