Andrena ferox

Smith, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records235

Data sources6

Biological traits1

DNA specimens15

eDNA detections4

Sources6 archives

Databases and archives Andrena ferox's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD15 specimens

01Narrative

De eikenzandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1847 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.88 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena ferox has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes2

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes1

BINs2

Where individuals differ — all 21 variable positions, in barcode order

24Amostly conserved

34Amostly conserved

36Tmostly conserved

78Cmostly conserved

96Cmostly conserved

111Cmostly conserved

162Amostly conserved

312Amostly conserved

318Tmostly conserved

339Tmostly conserved

366Cmostly conserved

402Tmostly conserved

423Tmostly conserved

435Cmostly conserved

480Tmostly conserved

501Tmostly conserved

543Amostly conserved

612Cmostly conserved

633Tmostly conserved

642Tmostly conserved

645Amostly conserved

TTATACTTTATTTTCGCCATATGAGCAGGAATAATTGGAGCATCATTAAGATTTATTATCCGAATAGAATTAAGAAACCCAGGAAGCTGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena bucephalasame genus7.7%Andrena trimmeranasame genus8.0%Andrena carantonicasame genus8.3%Andrena rosaesame genus8.4%Andrena nuptialissame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type235 records

Wild obs. + sensor106

Museum / vouchered125

Other4

Origin

Native58

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 9≤1 km 10≤10 km 79

98 georeferenced · 8 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 2≤1 km 6≤10 km 68

76 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dhaka, BD	12
Bern, CH	9
Bonn, DE	7
Bavarian State Collection of Zoologylocation not on record	5
ULglocation not on record	5
Zürich, CH	4
Paro, BT	4
ZSMlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Geneva, CH	2
Natuurpuntlocation not on record	2
PRUNlocation not on record	2
PRAZlocation not on record	2
Coimbra, PT	2
CBDClocation not on record	2
	2
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	1
TJWClocation not on record	1
Provincia di Livornolocation not on record	1
UMONSlocation not on record	1
University of Florence, Department of Biologylocation not on record	1
Musee d'Histoire Naturallelocation not on record	1
NAlocation not on record	1
MSVIlocation not on record	1

24 institutions · 74 of 125 vouchered records shown · 51 without an institution code

09Environmental DNA4 detections

Where the DNA of Andrena ferox was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 10.1–12.3

Seasonal swing summer↔winter17.0 °C

Max temp (day)15.7 °C 14.3–16.8

Min temp (night)5.80 °C 4.70–6.60

Precipitation80.9 mm/mo 62.5–92.4

Air humidity58.5 % 56.9–59.7

Moisture balance-23.1 mm/mo -28.1–-11.8

Vapour deficit552 Pa 516–615

Wind speed3.40 m/s 2.80–4.00

Cloud cover42.4 % 40.8–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)