Andrena bucephala

Stephens, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 314

Data sources9

Biological traits2

DNA specimens23

eDNA detections17

Sources9 archives

Databases and archives Andrena bucephala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 314 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 314 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · NCBI≈380 Mbp

01Narrative

Andrena bucephala is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1846 door Stephens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Hair length0.5 mm

Intertegular distance (ITD)2.17 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena bucephala has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

259Tmostly conserved

429Cmostly conserved

CTATACTTCATTTTTGCTATATGAGCAGGAATAATCGGAGCATCATTAAGATTTATTATCCGAATAGAATTAAGAAATCCAGGTAATTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes3

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena feroxsame genus7.7%Andrena nuptialissame genus8.9%Andrena trimmeranasame genus8.9%Andrena carantonicasame genus9.1%Andrena rosaesame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andrena bucephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈379 771 409 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena bucephala0.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.7% BUSCO

08Occurrence & distribution

Record type1 314 records

Wild obs. + sensor684

Museum / vouchered626

Other4

Origin

Native405

Range

Area of Occupancy AOO1 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 188≤1 km 53≤10 km 423>10 km 1

665 georeferenced · 19 without coordinates

Open the mapobservation + sensor684

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 10≤1 km 68≤10 km 489>10 km 6

573 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence626

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee d'Histoire Naturallelocation not on record	77
Bern, CH	54
Zürich, CH	36
Provincia di Livornolocation not on record	33
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	27
PRAZlocation not on record	17
NCMGlocation not on record	13
Wuzhou, CN	12
South Kensington, GB	7
ZSMlocation not on record	6
Museum zu Allerheiligen Schaffhausenlocation not on record	6
Paro, BT	5
Universität Zürich, Naturhistorisches Museumlocation not on record	4
PRUNlocation not on record	4
Geneva, CH	4
CBDClocation not on record	4
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
ARTlocation not on record	2
NMOKlocation not on record	2
	1

21 institutions · 320 of 626 vouchered records shown · 306 without an institution code

09Environmental DNA17 detections

Where the DNA of Andrena bucephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 8.50–13.6

Seasonal swing summer↔winter15.5 °C

Max temp (day)15.4 °C 12.9–17.6

Min temp (night)6.60 °C 3.20–8.30

Precipitation84.0 mm/mo 72.7–91.5

Air humidity59.8 % 58.8–60.6

Moisture balance-12.0 mm/mo -29.4–-1.00

Vapour deficit537 Pa 458–621

Wind speed3.80 m/s 3.40–4.30

Cloud cover42.4 % 39.5–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena bucephala

At a glance

Sources9 archives

Size & morphology2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 314 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 314 records