Andrena trimmerana

(Kirby, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 405

Data sources8

Biological traits1

DNA specimens55

eDNA detections8

Sources8 archives

Databases and archives Andrena trimmerana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 405 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD55 specimens

Genome at a glanceNCBI≈399 Mbp

01Narrative

Andrena trimmerana, Trimmer's mining bee, is a species of mining bee from the family Andrenidae. It occurs in the western Palearctic but its true status in some areas is muddled due to issues of taxonomy and misidentification.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.25 mm

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena trimmerana has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes2

eDNA detections8

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

40Cmostly conserved

49Amostly conserved

74Tmostly conserved

82Cmostly conserved

136Cvariable

142Cvariable

263Tmostly conserved

292Cmostly conserved

316Amostly conserved

343Tmostly conserved

364Tmostly conserved

367Cmostly conserved

385Tmostly conserved

403Gmostly conserved

430Gvariable

484Cmostly conserved

538Gmostly conserved

565Tmostly conserved

583Amostly conserved

616Tmostly conserved

619Tmostly conserved

AATACTTTACTTCATTTTCGCTATATGAGCAGGAATAATCGGAGCATCACTAAGATTTATTATCCGAATAGAATTAAGAAACCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes6

BIN1

Most divergent pair2.7%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena feroxsame genus8.0%Andrena bucephalasame genus8.9%Andrena rosaesame genus9.7%Andrena gelriaesame genus10.8%Andrena antonellaesame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceNCBI

The complete instruction manual Andrena trimmerana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈399 064 024 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena trimmerana0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 405 records

Wild obs. + sensor889

Museum / vouchered380

Other136

Origin

Native196

Range

Area of Occupancy AOO2 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 249≤1 km 87≤10 km 482>10 km 1

819 georeferenced · 70 without coordinates

Open the mapobservation + sensor889

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤1 km 38≤10 km 262>10 km 7

308 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence380

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	39
Wuzhou, CN	36
PRUNlocation not on record	19
Paro, BT	19
PRAZlocation not on record	18
Bern, CH	17
Musee d'Histoire Naturallelocation not on record	17
Cambridge, US	10
Zürich, CH	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Philadelphia, US	5
Bonn, DE	5
	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Gothenburg, SE	4
UGRlocation not on record	3
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	3
CBDClocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Natuurpuntlocation not on record	3
Centre Suisse de Cartographie de la Faunelocation not on record	2
ZSMlocation not on record	2
Tromsø, NO	2
AGClocation not on record	2
IMEDEAlocation not on record	2
Coimbra, PT	2
South Kensington, GB	2
MNHWlocation not on record	1
Geneva, CH	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Mons, BE	1

32 institutions · 250 of 380 vouchered records shown · 130 without an institution code

09Environmental DNA8 detections

Where the DNA of Andrena trimmerana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.1–18.4

Seasonal swing summer↔winter15.7 °C

Max temp (day)19.7 °C 16.2–22.5

Min temp (night)10.5 °C 7.00–13.2

Precipitation87.2 mm/mo 68.3–87.5

Air humidity59.9 % 59.0–59.9

Moisture balance-37.2 mm/mo -68.3–-14.2

Vapour deficit711 Pa 572–874

Wind speed3.20 m/s 3.00–3.70

Cloud cover41.9 % 39.8–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena trimmerana

At a glance

Sources8 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 405 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 405 records