Andrena pallidifovea

(Viereck, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 238

Data sources7

Biological traits1

DNA specimens34

eDNA detections48

Sources7 archives

Databases and archives Andrena pallidifovea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 238 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 238 records

Environmental DNA1 datasets · 2 countries48 detections

DNA & barcodingBOLD34 specimens

01Narrative

The pale-faced miner bee (Andrena pallidifovea) is a species of miner bee in the family Andrenidae. Another common name for this species is the pale-fovea andrena. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.0 mm

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena pallidifovea has left across the world's sequence archives.

At a glance

DNA specimens34

BINs5

Marker genes1

eDNA detections48

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

19Tvariable

58Cmostly conserved

82Cmostly conserved

91Cmostly conserved

136Cmostly conserved

142Cmostly conserved

157Tmostly conserved

253Gmostly conserved

263Cvariable

268Cmostly conserved

280Tmostly conserved

281Amostly conserved

303Cmostly conserved

316Gmostly conserved

337Tmostly conserved

347Tmostly conserved

367Tmostly conserved

376Cmostly conserved

394Cmostly conserved

403Tmostly conserved

427Tmostly conserved

433Tmostly conserved

451Cmostly conserved

457Tmostly conserved

475Tmostly conserved

490Cmostly conserved

496Tmostly conserved

526Cmostly conserved

532Tmostly conserved

536Tmostly conserved

539Tmostly conserved

544Cmostly conserved

548Tmostly conserved

550Amostly conserved

568Cmostly conserved

580Amostly conserved

586Amostly conserved

595Tmostly conserved

596Amostly conserved

598Amostly conserved

619Amostly conserved

628Amostly conserved

634Cmostly conserved

641Cmostly conserved

646Cmostly conserved

653Cmostly conserved

AATATTATATTTCATTTTTGCTATATGAGCAGGAATAATTGGAGCTTCACTAAGATTCATTATCCGAATAGAATTAAGAAACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes11

BINs5

Most divergent pair14.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena dorsatasame genus8.9%Andrena nasoniisame genus9.0%Andrena thomsoniisame genus9.1%Andrena lepidasame genus9.3%Andrena combinatasame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 238 records

Wild obs. + sensor4

Museum / vouchered1 098

Other136

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 70≤1 km 16≤10 km 149>10 km 3

238 georeferenced · 860 without coordinates

Open the institutions mapphysical evidence1 098

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	352
Wuzhou, CN	231
Weber State University, Bird and Mammal Collectionlocation not on record	141
Champaign, US	139
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	74
	58
US	29
La Jolla, US	14
WSUClocation not on record	14
Santa Cruz, US	13
OSUClocation not on record	8
Colorado State Universitylocation not on record	7
Vancouver, CA	3
WIlocation not on record	3
San Diego, US	2
University of Central Floridalocation not on record	2
Cambridge, US	1

17 institutions · 1 091 of 1 098 vouchered records shown · 7 without an institution code

09Environmental DNA48 detections

Where the DNA of Andrena pallidifovea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 7.20–18.4

Seasonal swing summer↔winter22.6 °C

Max temp (day)20.1 °C 14.2–26.0

Min temp (night)5.90 °C -0.1–10.5

Precipitation45.8 mm/mo 11.0–111

Air humidity51.4 % 46.1–54.8

Moisture balance-82.9 mm/mo -168–-18.2

Vapour deficit747 Pa 495–1,142

Wind speed3.00 m/s 1.90–3.50

Cloud cover36.5 % 24.9–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena pallidifovea

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 238 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 238 records