Andrena combinata

(Christ, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 982

Data sources6

Biological traits1

DNA specimens25

eDNA detections17

Sources6 archives

Databases and archives Andrena combinata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 982 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 982 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD25 specimens

01Narrative

De rimpelsnuit is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1791 door Christ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.14 mm

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena combinata has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

49Cmostly conserved

67Cmostly conserved

74Tmostly conserved

280Tmostly conserved

416Amostly conserved

539Tmostly conserved

557Tmostly conserved

583Cmostly conserved

616Cmostly conserved

628Amostly conserved

AATACTATACTTTATCTTCGCCATATGAGCAGGAATAATTGGAGCTTCCTTAAGATTTATTATTCGCATAGAATTAAGAAACCCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes3

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena mehelyisame genus4.7%Andrena lepidasame genus9.3%Andrena pallidifoveasame genus9.7%Andrena congruenssame genus10.2%Andrena confinissame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 982 records

Wild obs. + sensor734

Museum / vouchered1 188

Other60

Origin

Native700

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 17≤1 km 47≤10 km 653

717 georeferenced · 17 without coordinates

Open the mapobservation + sensor734

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 5≤1 km 54≤10 km 1 036>10 km 23

1 118 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence1 188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	259
Musee d'Histoire Naturallelocation not on record	85
Bern, CH	63
ULglocation not on record	56
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	48
Paro, BT	42
Provincia di Livornolocation not on record	40
Dhaka, BD	27
PRAZlocation not on record	22
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	20
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	18
ZSMlocation not on record	16
Museum zu Allerheiligen Schaffhausenlocation not on record	14
Wuzhou, CN	13
Bavarian State Collection of Zoologylocation not on record	8
PRUNlocation not on record	8
	8
Uniwersytet Łódzkilocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
NMOKlocation not on record	6
UMONSlocation not on record	6
Bonn, DE	5
Frauenfeld, CH	4
Geneva, CH	4
Muzeum Górnośląskie w Bytomiulocation not on record	2
University of Florence, Department of Biologylocation not on record	2
Cambridge, US	2
MNHWlocation not on record	2
KZMlocation not on record	2
IENElocation not on record	2
Coimbra, PT	1
Tilburg, NL	1
Mons, BE	1
Philadelphia, US	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
USALlocation not on record	1

36 institutions · 804 of 1 188 vouchered records shown · 384 without an institution code

09Environmental DNA17 detections

Where the DNA of Andrena combinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 10.7–17.1

Seasonal swing summer↔winter18.6 °C

Max temp (day)17.9 °C 14.9–21.2

Min temp (night)8.70 °C 4.90–12.5

Precipitation58.7 mm/mo 54.5–101

Air humidity57.7 % 53.9–60.1

Moisture balance-42.2 mm/mo -80.7–-7.40

Vapour deficit656 Pa 552–837

Wind speed3.10 m/s 2.00–3.90

Cloud cover35.0 % 31.5–35.6

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena combinata

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 982 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 982 records