Anaspis regimbarti

Schilsky, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records2 507

Data sources8

Biological traits0

DNA specimens40

eDNA detections53

Sources8 archives

Databases and archives Anaspis regimbarti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 507 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 507 records

Environmental DNA4 datasets · 7 countries53 detections

DNA & barcodingBOLD40 specimens

Genome at a glanceGoaT · NCBI≈458 Mbp

01Narrative

Anaspis regimbarti is een keversoort uit de familie bloemspartelkevers (Scraptiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1895 door Schilsky.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis regimbarti has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes2

eDNA detections53

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

CTTTATATTTCATTTTTGGTGCATGATCTGGAATAGTAGGAACTTCCCTAAGCCTATTAATTCGATCTGAATTAGGTACTCCTGGTTCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis garneysisame genus11.1%Anaspis rufasame genus11.5%Anaspis ruficollissame genus11.9%Anaspis marginicollissame genus12.1%Anaspis flavipennissame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anaspis regimbarti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈457 613 942 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anaspis regimbarti0.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.4% BUSCO

08Occurrence & distribution

Record type2 507 records

Wild obs. + sensor2 093

Museum / vouchered226

Other188

Range

Area of Occupancy AOO5 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 831≤1 km 548≤10 km 658>10 km 17

2 054 georeferenced · 39 without coordinates

Open the mapobservation + sensor2 093

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 40≤1 km 40≤10 km 89

169 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	45
NCMGlocation not on record	42
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	41
CBDClocation not on record	23
Tilburg, NL	13
South Kensington, GB	7
ZSMlocation not on record	4
Natural History Museum Rotterdamlocation not on record	2
Natural History Museum, Londonlocation not on record	1

9 institutions · 178 of 226 vouchered records shown · 48 without an institution code

09Environmental DNA53 detections

Where the DNA of Anaspis regimbarti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys4

Countries7

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.4. Temperate ForestUrban1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.2–17.4

Seasonal swing summer↔winter12.8 °C

Max temp (day)18.2 °C 15.1–22.4

Min temp (night)10.4 °C 7.20–13.0

Precipitation62.0 mm/mo 47.1–76.1

Air humidity60.1 % 58.6–62.7

Moisture balance-56.3 mm/mo -66.7–-29.0

Vapour deficit663 Pa 529–833

Wind speed3.70 m/s 2.60–4.30

Cloud cover39.4 % 36.8–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis regimbarti

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 507 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 507 records