Anaspis garneysi

Fowler, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records1 452

Data sources6

Biological traits0

DNA specimens9

eDNA detections30

Sources6 archives

Databases and archives Anaspis garneysi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 452 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 452 records

Environmental DNA2 datasets · 4 countries30 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anaspis garneysi is een keversoort uit de familie bloemspartelkevers (Scraptiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Fowler.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis garneysi has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections30

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTGTATTTTATTTTTGGTGCATGATCAGGAATAGTGGGAACTTCCCTCAGCTTACTAATTCGATCTGAACTAGGAACTCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis ruficollissame genus10.5%Anaspis regimbartisame genus11.1%Anaspis arcticasame genus12.9%Anaspis flavasame genus13.2%Anaspis proteussame genus14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 452 records

Wild obs. + sensor1 281

Museum / vouchered24

Other147

Range

Area of Occupancy AOO2 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 542≤1 km 215≤10 km 486>10 km 10

1 253 georeferenced · 28 without coordinates

Open the mapobservation + sensor1 281

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 10

11 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	4
CBDClocation not on record	3
Natural History Museum, Londonlocation not on record	3
Barcelona, ES	2
South Kensington, GB	2

5 institutions · 14 of 24 vouchered records shown · 10 without an institution code

09Environmental DNA30 detections

Where the DNA of Anaspis garneysi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.9–15.0

Seasonal swing summer↔winter12.1 °C

Max temp (day)16.8 °C 14.2–18.5

Min temp (night)9.20 °C 7.00–11.4

Precipitation65.7 mm/mo 49.2–99.9

Air humidity61.8 % 59.8–65.7

Moisture balance-40.5 mm/mo -64.4–-16.7

Vapour deficit583 Pa 489–660

Wind speed4.20 m/s 3.30–5.50

Cloud cover44.2 % 34.9–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis garneysi

At a glance

Sources6 archives

At a glance

Record type1 452 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 452 records