Anaspis ruficollis

(Fabricius, 1792) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records1 476

Data sources7

Biological traits0

DNA specimens13

eDNA detections15

Sources7 archives

Databases and archives Anaspis ruficollis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 476 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 476 records

Environmental DNA2 datasets · 2 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Mordella ruficollis is a species of beetle in the genus Mordella of the family Mordellidae, which is part of the superfamily Tenebrionoidea. It was discovered in 1878.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis ruficollis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

235Cmostly conserved

427Tmostly conserved

502Amostly conserved

583Tmostly conserved

AACTTTATATTTCATTTTTGGTGCATGATCAGGAATAGTAGGAACTTCCCTCAGCTTACTAATTCGATCTGAACTAGGAACTCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes5

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis garneysisame genus10.5%Anaspis arcticasame genus11.2%Anaspis rufasame genus11.5%Anaspis flavipennissame genus11.5%Anaspis rayisame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 476 records

Wild obs. + sensor989

Museum / vouchered118

Cultivated / captive1

Other368

Range

Area of Occupancy AOO1 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 92≤1 km 34≤10 km 657>10 km 40

823 georeferenced · 166 without coordinates

Open the mapobservation + sensor989

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 14≤1 km 28≤10 km 8>10 km 1

51 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	18
Provincia di Livornolocation not on record	14
IFR-DNFlocation not on record	13
ZSMlocation not on record	12
SLU Artdatabankenlocation not on record	8
Ugentlocation not on record	6
Trondheim, NO	5
NMOKlocation not on record	5
Helsinki, FI	2
Salzburg, AT	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

11 institutions · 85 of 118 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Anaspis ruficollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

Nadelwald, Mittelgebirgswieseaus rotfaulem Holz einer liegenden Altbuche …Halbtrockenrasenvon Totholz und aus der Vegetation geklopft

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 13.2–17.7

Seasonal swing summer↔winter17.7 °C

Max temp (day)19.2 °C 17.2–21.8

Min temp (night)11.0 °C 8.10–13.3

Precipitation71.7 mm/mo 61.5–141

Air humidity60.2 % 58.3–63.4

Moisture balance-44.9 mm/mo -60.3–23.1

Vapour deficit671 Pa 568–854

Wind speed3.30 m/s 1.90–4.20

Cloud cover34.2 % 30.5–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis ruficollis

At a glance

Sources7 archives

At a glance

Record type1 476 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 476 records