Anaspis rufa

Say, 1826 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records1 746

Data sources7

Biological traits0

DNA specimens1 159

eDNA detections1 034

Sources7 archives

Databases and archives Anaspis rufa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 034 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 159 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 746 records

Environmental DNA1 datasets · 2 countries1 034 detections

DNA & barcodingBOLD1 159 specimens

01Narrative

Anaspis rufa is a species of false flower beetle in the family Scraptiidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 159 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis rufa has left across the world's sequence archives.

At a glance

DNA specimens1 159

BINs5

Marker genes2

eDNA detections1 034

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus958 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 77 variable positions, in barcode order

4Cvariable

21Cvariable

54Tvariable

66Gmostly conserved

81Cvariable

84Cvariable

87Tmostly conserved

90Tvariable

114Cmostly conserved

117Tmostly conserved

153Tvariable

177Tmostly conserved

180Amostly conserved

183Cmostly conserved

195Amostly conserved

196Tmostly conserved

201Tmostly conserved

211Tvariable

219Tvariable

225Tvariable

234Cvariable

243Gvariable

249Cvariable

258Cvariable

261Avariable

262Tmostly conserved

264Gvariable

267Tvariable

270Cvariable

276Avariable

277Tmostly conserved

312Tmostly conserved

315Amostly conserved

321Gmostly conserved

333Amostly conserved

339Cmostly conserved

342Cmostly conserved

345Tvariable

346Cmostly conserved

348Avariable

351Amostly conserved

363Tmostly conserved

366Tvariable

384Tmostly conserved

405Cvariable

411Tvariable

414Amostly conserved

420Avariable

429Avariable

432Avariable

441Cmostly conserved

471Amostly conserved

477Avariable

481Tmostly conserved

483Cvariable

489Cmostly conserved

498Gvariable

499Tmostly conserved

513Tmostly conserved

522Cvariable

531Tmostly conserved

541Cmostly conserved

546Tmostly conserved

552Tmostly conserved

555Tmostly conserved

567Tmostly conserved

573Tmostly conserved

580Cmostly conserved

582Amostly conserved

603Tvariable

615Cmostly conserved

621Tvariable

624Amostly conserved

627Avariable

630Avariable

633Cvariable

636Amostly conserved

ACTCTATATTTCATTTTTGGCGCATGATCAGGAATAGTAGGAACTTCCCTCAGTCTACTAATTCGGTCTGAATTAGGAACCCCCGGTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 52 variants.

Diversity (π)4.9%

Haplotypes52

BINs5

Most divergent pair8.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis kiesenwetterisame genus6.5%Anaspis arcticasame genus7.9%Anaspis ruficollissame genus11.5%Anaspis regimbartisame genus11.5%Anaspis rayisame genus12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type1 746 records

Wild obs. + sensor19

Museum / vouchered1 727

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 8

16 georeferenced · 3 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 292≤1 km 59≤10 km 64>10 km 4

419 georeferenced · 1 308 without coordinates

Open the institutions mapphysical evidence1 727

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	567
Edmonton, CA	323
University Park, US	120
Santa Barbara Museum of Natural Historylocation not on record	41
University of Guelphlocation not on record	38
Lexington, US	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Cambridge, US	5
Biodiversity Institute of Ontariolocation not on record	5
Albuquerque, US	4
Royal Saskatchewan Museumlocation not on record	3
East Lansing, US	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Chicago, US	1
University of Nebraska State Museumlocation not on record	1
ASUlocation not on record	1
Saint John, CA	1
Centre for Biodiversity Genomicslocation not on record	1

18 institutions · 1 126 of 1 727 vouchered records shown · 601 without an institution code

09Environmental DNA1 034 detections

Where the DNA of Anaspis rufa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 034

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 034 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.4. Temperate Forest5. Wetlands (inland)1. Forest & Woodland | 1.1. Boreal Forest1. Forest & Woodland|1.2 Subarctic ForestBog Forest, Cedar-Salal Forest, Zonal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.2–17.0

Seasonal swing summer↔winter24.5 °C

Max temp (day)18.2 °C 14.1–22.0

Min temp (night)10.8 °C 4.20–14.2

Precipitation121 mm/mo 64.7–158

Air humidity61.1 % 55.0–65.8

Moisture balance-4.20 mm/mo -71.4–49.1

Vapour deficit649 Pa 486–822

Wind speed3.10 m/s 1.80–8.30

Cloud cover47.0 % 33.7–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 1 032 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis rufa

At a glance

Sources7 archives

At a glance

Record type1 746 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 746 records