Anaspis flavipennis

Haldeman, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records37

Data sources7

Biological traits0

DNA specimens338

eDNA detections338

Sources7 archives

Databases and archives Anaspis flavipennis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI338 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics338 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 2 countries338 detections

DNA & barcodingBOLD338 specimens

01Narrative

Anaspis flavipennis is a species of false flower beetle in the family Scraptiidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding338 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis flavipennis has left across the world's sequence archives.

At a glance

DNA specimens338

BINs1

Marker genes1

eDNA detections338

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus315 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

63Cvariable

114Tmostly conserved

204Amostly conserved

240Gmostly conserved

261Amostly conserved

315Amostly conserved

432Amostly conserved

543Avariable

603Amostly conserved

621Gmostly conserved

627Amostly conserved

ACTCTCTATTTCATTTTTGGAGCTTGATCAGGAATAGTAGGAACTTCCCTCAGCCTATTAATCCGATCAGAGCTTGGTACTCCTGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes9

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis rufilabrissame genus9.2%Anaspis ruficollissame genus11.5%Anaspis rufasame genus12.2%Anaspis melanostomasame genus12.2%Anaspis flavasame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor4

Museum / vouchered33

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
University Park, US	2
CUlocation not on record	1
Cambridge, US	1
MAJClocation not on record	1
Saint John, CA	1

8 institutions · 33 of 33 vouchered records shown

09Environmental DNA338 detections

Where the DNA of Anaspis flavipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found338

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 338 detections have coordinates

Open the map2 countries0

Temperate mixed forest1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestfarmGrasslandWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 10.9–18.0

Seasonal swing summer↔winter27.7 °C

Max temp (day)18.1 °C 14.5–23.1

Min temp (night)11.4 °C 5.70–14.2

Precipitation106 mm/mo 81.1–136

Air humidity59.7 % 55.6–63.1

Moisture balance-10.9 mm/mo -43.2–11.3

Vapour deficit646 Pa 498–819

Wind speed2.70 m/s 2.30–5.40

Cloud cover47.7 % 42.8–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 332 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)