Anaspis flava

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records3 409

Data sources6

Biological traits0

DNA specimens59

eDNA detections365

Sources6 archives

Databases and archives Anaspis flava's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 409 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI365 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 409 records

Environmental DNA4 datasets · 9 countries365 detections

DNA & barcodingBOLD59 specimens

01Narrative

Anaspis flava is een keversoort uit de familie van de bloemspartelkevers (Scraptiidae). De wetenschappelijke naam is gepubliceerd in 1758 door Carl Linnaeus in de tiende editie van Systema naturae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis flava has left across the world's sequence archives.

At a glance

DNA specimens59

BINs2

Marker genes1

eDNA detections365

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

21Amostly conserved

66Amostly conserved

126Tvariable

138Cvariable

162Tvariable

172Tvariable

186Tvariable

196Cvariable

219Tvariable

222Tvariable

234Cvariable

346Cvariable

354Cvariable

363Tvariable

378Tvariable

427Cvariable

432Avariable

435Cvariable

444Tvariable

471Tvariable

483Tvariable

501Cvariable

532Tvariable

535Tvariable

541Cvariable

561Cmostly conserved

580Tvariable

615Tmostly conserved

627Amostly conserved

ACACTTTATTTCATCTTTGGAGCATGATCAGGAATAGTAGGAACTTCCCTTAGCCTATTAATTCGATCAGAGCTTGGAACTCCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs2

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis melanostomasame genus9.3%Anaspis costaisame genus9.9%Anaspis rayisame genus11.0%Anaspis atratasame genus11.7%Anaspis varianssame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 409 records

Wild obs. + sensor2 558

Museum / vouchered528

Cultivated / captive9

Other314

Range

Area of Occupancy AOO5 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 1 337≤1 km 350≤10 km 576>10 km 12

2 275 georeferenced · 283 without coordinates

Open the mapobservation + sensor2 558

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 176≤1 km 161≤10 km 104>10 km 21

462 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence528

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	161
Olocation not on record	36
Provincia di Livornolocation not on record	34
Trondheim, NO	31
Tilburg, NL	30
NHMOlocation not on record	24
Helsinki, FI	23
NMOKlocation not on record	23
ZSMlocation not on record	10
BioFokuslocation not on record	8
neflocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
LSMlocation not on record	7
NTNU-VMlocation not on record	6
Paris, FR	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
NMBU:MINAlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Chicago, US	2
Salzburg, AT	1
Barcelona, ES	1
Ugentlocation not on record	1
MZLUlocation not on record	1

24 institutions · 431 of 528 vouchered records shown · 97 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA365 detections

Where the DNA of Anaspis flava was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found365

Studies independent surveys4

Countries9

Verifiable raw sequence linked296

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 365 detections have coordinates

Open the map9 countries0

UrbanLaubwaldmerenranta, aurinkoinen metsAÂ¤nreunaForest edge (suburban)Garden lawnAuwaldrest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.2–16.8

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.6 °C 17.0–20.5

Min temp (night)10.6 °C 8.90–13.0

Precipitation68.3 mm/mo 56.7–92.1

Air humidity59.4 % 57.2–61.0

Moisture balance-46.9 mm/mo -59.4–-16.9

Vapour deficit674 Pa 610–791

Wind speed3.00 m/s 2.20–4.20

Cloud cover42.1 % 38.5–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 365 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis flava

At a glance

Sources6 archives

At a glance

Record type3 409 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 409 records