Anaspis atrata

Champion, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records194

Data sources7

Biological traits0

DNA specimens45

eDNA detections45

Sources7 archives

Databases and archives Anaspis atrata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF194 records

Environmental DNA1 datasets · 1 countries45 detections

DNA & barcodingBOLD45 specimens

01Narrative

Anaspis atrata is a species of false flower beetle in the family Scraptiidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis atrata has left across the world's sequence archives.

At a glance

DNA specimens45

BINs2

Marker genes2

eDNA detections45

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

3Tvariable

84Tvariable

111Tvariable

153Tvariable

205Cvariable

270Cmostly conserved

303Avariable

345Cvariable

363Cvariable

366Tvariable

373Tvariable

375Tvariable

438Tvariable

468Avariable

483Cvariable

549Gvariable

601Amostly conserved

615Cvariable

618Cvariable

651Tvariable

ACTCTATACTTTATCTTTGGAGCATGATCAGGAATAGTAGGAACCTCCCTAAGCCTACTTATTCGATCTGAGCTTGGAACCCCTGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes6

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis flavasame genus11.7%Anaspis rayisame genus12.1%Anaspis ruficollissame genus12.3%Anaspis flavipennissame genus13.0%Anaspis duryisame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type194 records

Museum / vouchered194

Range

Area of Occupancy AOO240 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence194

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	143
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
Royal Saskatchewan Museumlocation not on record	11
Albuquerque, US	1
Chicago, US	1
ASUlocation not on record	1

6 institutions · 177 of 194 vouchered records shown · 17 without an institution code

09Environmental DNA45 detections

Where the DNA of Anaspis atrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map1 country0

Forest1. Forest & Woodland | 1.1. Boreal ForestGrasslandWetland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 4.90–13.1

Seasonal swing summer↔winter31.2 °C

Max temp (day)15.5 °C 10.8–18.7

Min temp (night)6.40 °C -0.1–8.80

Precipitation89.7 mm/mo 49.3–148

Air humidity56.1 % 54.2–63.0

Moisture balance-28.3 mm/mo -62.0–68.2

Vapour deficit521 Pa 362–676

Wind speed3.40 m/s 2.20–7.90

Cloud cover40.3 % 36.9–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)