Anaspis duryi

Liljeblad, 1945 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records27

Data sources7

Biological traits0

DNA specimens188

eDNA detections181

Sources7 archives

Databases and archives Anaspis duryi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI181 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics188 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 2 countries181 detections

DNA & barcodingBOLD188 specimens

01Narrative

Anaspis duryi is a species of false flower beetle in the family Scraptiidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding188 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis duryi has left across the world's sequence archives.

At a glance

DNA specimens188

BINs1

Marker genes1

eDNA detections181

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus180 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

112Cmostly conserved

178Amostly conserved

193Amostly conserved

194Cmostly conserved

226Avariable

301Cmostly conserved

313Tvariable

325Avariable

334Amostly conserved

406Tvariable

469Tvariable

481Gvariable

505Tvariable

541Cmostly conserved

547Cmostly conserved

565Avariable

580Avariable

583Avariable

649Tmostly conserved

TTTATATTTCATTTTTGGCGCATGATCCGGAATAGTAGGAACCTCCCTAAGCCTACTAATTCGATCTGAATTAGGAACTCCAGGTTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes22

BIN1

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis rayisame genus11.3%Anaspis kiesenwetterisame genus11.9%Anaspis arcticasame genus12.6%Anaspis marginicollissame genus12.7%Anaspis ruficollissame genus12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor2

Museum / vouchered25

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	12
Royal British Columbia Museumlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Washington, US	1

4 institutions · 21 of 25 vouchered records shown · 4 without an institution code

09Environmental DNA181 detections

Where the DNA of Anaspis duryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found181

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 181 detections have coordinates

Open the map2 countries0

WetlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 14.1–18.2

Seasonal swing summer↔winter10.9 °C

Max temp (day)18.7 °C 16.2–21.1

Min temp (night)14.2 °C 12.0–16.2

Precipitation19.9 mm/mo 0.6–36.4

Air humidity60.3 % 59.1–65.0

Moisture balance-93.7 mm/mo

Vapour deficit677 Pa 632–826

Wind speed3.60 m/s

Cloud cover31.7 % 9.90–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 181 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)