Anaspis costai

Emery, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records502

Data sources6

Biological traits0

DNA specimens22

eDNA detections20

Sources6 archives

Databases and archives Anaspis costai's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF502 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD22 specimens

01Narrative

Anaspis costai is een keversoort uit de familie bloemspartelkevers (Scraptiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1876 door Emery.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis costai has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes2

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

169Amostly conserved

337Tmostly conserved

604Amostly conserved

AACACTTTATTTTATCTTTGGCGCATGATCAGGAATAGTAGGAACTTCCCTCAGTCTATTAATCCGATCAGAATTAGGAACTCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis flavasame genus9.9%Anaspis melanostomasame genus10.0%Anaspis frontalissame genus11.8%Pectotoma hoppingisame family12.3%Phaea giesbertisame order12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type502 records

Wild obs. + sensor408

Museum / vouchered49

Cultivated / captive4

Fossil1

Other40

Range

Area of Occupancy AOO1 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 158≤1 km 66≤10 km 165>10 km 2

391 georeferenced · 17 without coordinates

Open the mapobservation + sensor408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 16≤10 km 10

30 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence49

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NMOKlocation not on record	17
ZSMlocation not on record	10
Salzburg, AT	4
CBDClocation not on record	3
Provincia di Livornolocation not on record	3
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

7 institutions · 39 of 49 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Anaspis costai was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

LaubwaldAuwaldaus der Kraut- und Strauchschicht gekeschert…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 10.1–17.2

Seasonal swing summer↔winter16.0 °C

Max temp (day)18.7 °C 13.3–21.3

Min temp (night)10.0 °C 6.60–12.4

Precipitation71.6 mm/mo 56.0–76.0

Air humidity60.5 % 58.2–65.0

Moisture balance-38.0 mm/mo -51.4–3.50

Vapour deficit664 Pa 474–796

Wind speed3.10 m/s 2.60–4.60

Cloud cover35.3 % 33.3–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)