Anania lancealis

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records5 813

Data sources7

Biological traits0

DNA specimens35

eDNA detections33

Sources7 archives

Databases and archives Anania lancealis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 813 records

Environmental DNA1 datasets · 7 countries33 detections

DNA & barcodingBOLD35 specimens

01Narrative

Anania lancealis is a species of moth of the family Crambidae, described by the Austrian lepidopterists Michael Denis and Ignaz Schiffermüller in 1775. The moth is found in Asia and Europe. Mounted specimen

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania lancealis has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections33

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

25Cmostly conserved

578Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATCTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes13

BIN1

Most divergent pair0.61%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania flavasame genus6.7%Anania crocealissame genus7.6%Anania perlucidalissame genus7.8%Anania fuscalissame genus8.1%Anania tertialissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 813 records

Wild obs. + sensor5 330

Museum / vouchered481

Other2

Origin

Native8

Range

Area of Occupancy AOO8 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 1 944≤1 km 542≤10 km 2 172>10 km 20

4 678 georeferenced · 652 without coordinates

Open the mapobservation + sensor5 330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 273≤1 km 76≤10 km 89>10 km 3

441 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	300
Zürich, CH	48
Tartu, EE	20
Nijmegen, NL	15
Natural History Museum Rotterdamlocation not on record	14
Helsinki, FI	10
Philadelphia, US	7
SLU Artdatabankenlocation not on record	6
CBDClocation not on record	5
Provincia di Livornolocation not on record	4
Uniwersytet Łódzkilocation not on record	4
South Kensington, GB	4
Natural History Museum, Londonlocation not on record	3
ZSMlocation not on record	2
MZLUlocation not on record	2
Kuopio, FI	1
Research Collection of Hartmut Wegnerlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1

18 institutions · 447 of 481 vouchered records shown · 34 without an institution code

09Environmental DNA33 detections

Where the DNA of Anania lancealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 11.0–19.7

Seasonal swing summer↔winter19.6 °C

Max temp (day)20.6 °C 15.0–23.9

Min temp (night)11.5 °C 4.90–15.3

Precipitation81.6 mm/mo 47.3–198

Air humidity59.4 % 57.0–63.9

Moisture balance-35.2 mm/mo -91.0–75.8

Vapour deficit728 Pa 542–996

Wind speed2.70 m/s 1.30–4.30

Cloud cover36.3 % 30.7–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania lancealis

At a glance

Sources7 archives

At a glance

Record type5 813 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 813 records