Anania tertialis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records386

Data sources7

Biological traits0

DNA specimens97

eDNA detections134

Sources7 archives

Databases and archives Anania tertialis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility386 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI134 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF386 records

Environmental DNA1 datasets · 2 countries134 detections

DNA & barcodingBOLD97 specimens

01Narrative

Anania plectilis is a moth in the family Crambidae. It was described by Augustus Radcliffe Grote and Coleman Townsend Robinson in 1867. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania tertialis has left across the world's sequence archives.

At a glance

DNA specimens97

BINs1

Marker genes1

eDNA detections134

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

184Gmostly conserved

514Gvariable

542Cmostly conserved

578Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes17

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania coronatasame genus3.2%Anania perlucidalissame genus6.5%Anania flavasame genus7.8%Anania lancealissame genus8.1%Paliga mandronalissame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type386 records

Wild obs. + sensor184

Museum / vouchered202

Range

Area of Occupancy AOO880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 92≤1 km 27≤10 km 10>10 km 10

139 georeferenced · 45 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 5≤1 km 9≤10 km 40>10 km 19

73 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	38
University of Guelph, Centre for Biodiversity Genomicslocation not on record	26
Philadelphia, US	25
St. Paul, US	16
Decorah, US	6
Washington, US	6
Edmonton, CA	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
SOVTlocation not on record	3
Cambridge, US	1
Mississippi State, US	1
Philadelphia, US	1
San Francisco, US	1
Cornell University Insect Collectionlocation not on record	1

14 institutions · 133 of 202 vouchered records shown · 69 without an institution code

09Environmental DNA134 detections

Where the DNA of Anania tertialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found134

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 134 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forestGrasslandWetland1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 12.8–20.1

Seasonal swing summer↔winter25.7 °C

Max temp (day)20.5 °C 16.6–24.7

Min temp (night)12.2 °C 7.10–16.6

Precipitation102 mm/mo 75.6–149

Air humidity58.8 % 56.3–64.0

Moisture balance-31.2 mm/mo -72.7–45.4

Vapour deficit706 Pa 529–959

Wind speed2.70 m/s 1.80–4.40

Cloud cover40.9 % 31.5–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 124 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)