Anania perlucidalis

(Hübner, 1809) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records6 125

Data sources7

Biological traits0

DNA specimens26

eDNA detections26

Sources7 archives

Databases and archives Anania perlucidalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 125 records

Environmental DNA1 datasets · 6 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Anania perlucidalis, the fenland pearl, is a species of moth of the family Crambidae. It was described by Jacob Hübner in 1809 and is found in Europe. The wingspan is 21–23 mm. The moth flies from June to August depending on the location. The larvae feed on Cirsium oleraceum and other Cirsium species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania perlucidalis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections26

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGTATTTGAAGAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes4

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania quebecensissame genus4.7%Anania flavasame genus6.1%Anania crocealissame genus6.1%Pyrausta perrubralissame family6.2%Anania dionalissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 125 records

Wild obs. + sensor5 338

Museum / vouchered787

Origin

Native11

Range

Area of Occupancy AOO7 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 2 114≤1 km 883≤10 km 2 160>10 km 20

5 177 georeferenced · 161 without coordinates

Open the mapobservation + sensor5 338

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 269≤1 km 182≤10 km 232>10 km 67

750 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence787

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	272
DanishLepidopterologicalSocietylocation not on record	234
NHMOlocation not on record	59
Kuopio, FI	42
Tartu, EE	26
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	14
DABUHlocation not on record	14
Philadelphia, US	11
SLU Artdatabankenlocation not on record	10
BioFokuslocation not on record	6
Rovaniemi, FI	6
ZMAAlocation not on record	6
Nijmegen, NL	3
NTNU-VMlocation not on record	2
NMBU:MINAlocation not on record	2
Provincia di Livornolocation not on record	2
neflocation not on record	2
Metsähallituslocation not on record	1
Zürich, CH	1
Research Collection of Theo Gruenewaldlocation not on record	1

20 institutions · 714 of 787 vouchered records shown · 73 without an institution code

09Environmental DNA26 detections

Where the DNA of Anania perlucidalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 5.70–19.8

Seasonal swing summer↔winter18.2 °C

Max temp (day)17.5 °C 7.30–24.4

Min temp (night)12.1 °C 3.90–14.6

Precipitation67.6 mm/mo 54.3–101

Air humidity60.2 % 57.2–65.7

Moisture balance-24.1 mm/mo -73.1–9.70

Vapour deficit667 Pa 375–1,013

Wind speed3.30 m/s 2.10–5.90

Cloud cover42.5 % 33.5–54.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania perlucidalis

At a glance

Sources7 archives

At a glance

Record type6 125 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 125 records