Anania crocealis

(Hübner, 1796) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records2 882

Data sources9

Biological traits0

DNA specimens46

eDNA detections56

Sources9 archives

Databases and archives Anania crocealis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 882 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 882 records

Environmental DNA1 datasets · 11 countries56 detections

DNA & barcodingBOLD46 specimens

Genome at a glanceGoaT · NCBI≈624 Mbp

01Narrative

Anania crocealis is a species of moth of the family Crambidae. It was described by Jacob Hübner in 1796 and is found in Europe. The wingspan is 22–25 mm. Forewings yellow-ochreous ; lines fuscous, first curved, second curved, strongly sinuate inwards below middle ; orbicular dot and linear discal mark fuscous ; a dark fuscous terminal line. Hindwings whitish grey, with faint darker second line. Larva dull green ; dorsal line dark greenish-grey ; head black.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Figs 1 larva after final moult The larvae feed on Pulicaria dysenterica, Inula conyzae and Inula salicina. The moth flies from June to September depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania crocealis has left across the world's sequence archives.

At a glance

DNA specimens46

BINs2

Marker genes1

eDNA detections56

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

100Amostly conserved

262Amostly conserved

274Tmostly conserved

340Cmostly conserved

412Cmostly conserved

478Tmostly conserved

628Amostly conserved

TACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes13

BINs2

Most divergent pair7.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania flavasame genus5.8%Anania perlucidalissame genus6.1%Crocidophora serratissimalissame family6.2%Crocidophora pustuliferalissame family6.4%Crocidophora tuberculalissame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anania crocealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈623 979 160 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anania crocealis0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type2 882 records

Wild obs. + sensor2 550

Museum / vouchered331

Other1

Origin

Native8

Range

Area of Occupancy AOO5 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 133≤1 km 362≤10 km 745>10 km 36

2 276 georeferenced · 274 without coordinates

Open the mapobservation + sensor2 550

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 14≤1 km 58≤10 km 114>10 km 102

288 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	191
Zürich, CH	33
Nijmegen, NL	19
Tartu, EE	16
SLU Artdatabankenlocation not on record	9
Natural History Museum Rotterdamlocation not on record	9
DanishLepidopterologicalSocietylocation not on record	6
Provincia di Livornolocation not on record	3
Philadelphia, US	3
Radicondoli, IT	3
CBDClocation not on record	2
Rovaniemi, FI	2
Kuopio, FI	2
Metsähallituslocation not on record	2
NHMOlocation not on record	2
MZLUlocation not on record	2
South Kensington, GB	2
New Haven, US	1
ZSMlocation not on record	1

19 institutions · 308 of 331 vouchered records shown · 23 without an institution code

09Environmental DNA56 detections

Where the DNA of Anania crocealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map11 countries0

dry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 10.2–20.9

Seasonal swing summer↔winter19.1 °C

Max temp (day)19.1 °C 14.7–24.2

Min temp (night)12.1 °C 5.20–15.9

Precipitation70.5 mm/mo 33.1–149

Air humidity60.4 % 56.0–62.5

Moisture balance-46.4 mm/mo -105–123

Vapour deficit747 Pa 484–1,053

Wind speed2.80 m/s 1.80–6.90

Cloud cover37.2 % 30.4–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania crocealis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 882 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 882 records