Anania fuscalis

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records13 906

Data sources5

Biological traits0

DNA specimens72

eDNA detections60

Sources5 archives

Databases and archives Anania fuscalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility13 906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF13 906 records

Environmental DNA3 datasets · 10 countries60 detections

DNA & barcodingBOLD72 specimens

Genome at a glanceGoaT≈564 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania fuscalis has left across the world's sequence archives.

At a glance

DNA specimens72

BINs4

Marker genes1

eDNA detections60

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus71 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

82Tvariable

166Amostly conserved

268Amostly conserved

271Cmostly conserved

274Tvariable

328Amostly conserved

347Cvariable

349Cvariable

364Avariable

448Cmostly conserved

478Avariable

479Avariable

550Tvariable

581Tvariable

622Amostly conserved

628Gmostly conserved

TACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes16

BINs4

Most divergent pair2.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania flavasame genus5.0%Anania extricalissame genus6.1%Anania dionalissame genus6.2%Anania terrealissame genus6.2%Anania mysippusalissame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anania fuscalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈563 922 727 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anania fuscalis0.56 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type13 906 records

Wild obs. + sensor11 948

Museum / vouchered1 947

Other11

Range

Area of Occupancy AOO16 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 6 271≤1 km 3 424≤10 km 1 765>10 km 23

11 483 georeferenced · 465 without coordinates

Open the mapobservation + sensor11 948

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 291≤1 km 534≤10 km 642>10 km 365

1 832 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence1 947

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 141
NHMOlocation not on record	131
DanishLepidopterologicalSocietylocation not on record	90
Tartu, EE	70
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	49
Salzburg, AT	48
Zürich, CH	42
Kuopio, FI	36
NTNU-VMlocation not on record	30
SLU Artdatabankenlocation not on record	29
Rovaniemi, FI	25
Philadelphia, US	17
CBDClocation not on record	16
ZMAAlocation not on record	13
Nijmegen, NL	9
Uniwersytet Łódzkilocation not on record	8
neflocation not on record	7
BioFokuslocation not on record	6
Metsähallituslocation not on record	4
University of Kaiserslauternlocation not on record	4
DABUHlocation not on record	4
NMBU:MINAlocation not on record	2
MZLUlocation not on record	2
South Kensington, GB	2
ZSMlocation not on record	1
Landesmuseum Kaerntenlocation not on record	1

26 institutions · 1 787 of 1 947 vouchered records shown · 160 without an institution code

09Environmental DNA60 detections

Where the DNA of Anania fuscalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys3

Countries10

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map10 countries0

Fen edgedry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 8.80–18.8

Seasonal swing summer↔winter21.1 °C

Max temp (day)18.5 °C 11.7–23.2

Min temp (night)10.2 °C 3.20–13.9

Precipitation97.9 mm/mo 67.5–204

Air humidity60.0 % 55.8–64.0

Moisture balance-13.0 mm/mo -47.2–99.6

Vapour deficit683 Pa 420–918

Wind speed2.70 m/s 1.90–4.80

Cloud cover40.1 % 31.4–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania fuscalis

At a glance

Sources5 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type13 906 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 906 records