Anania mysippusalis

Walker, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records320

Data sources6

Biological traits0

DNA specimens37

eDNA detections2

Sources6 archives

Databases and archives Anania mysippusalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD37 specimens

01Narrative

Anania mysippusalis is a moth in the family Crambidae. It was described by Francis Walker in 1859. It is found in North America, where it has been recorded from Nova Scotia to British Columbia, south in the west to California and Arizona.Moth Photographers Group. Mississippi State University. The wingspan is about 26 mm. The forewings and hindwings are medium brown with dark brown lines. Adults are on wing from May to August in California.BugGuide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania mysippusalis has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

118Cvariable

160Amostly conserved

166Avariable

181Amostly conserved

202Tvariable

268Gmostly conserved

287Cvariable

370Avariable

508Avariable

535Avariable

619Avariable

628Avariable

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAAGAGGAATAGTAGGAACATCTTTAAGCTTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes10

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania fuscalissame genus6.7%Anania flavasame genus6.8%Anania extricalissame genus7.1%Anania dionalissame genus7.1%Anania perlucidalissame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type320 records

Wild obs. + sensor202

Museum / vouchered118

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 114≤1 km 33≤10 km 4>10 km 16

167 georeferenced · 35 without coordinates

Open the mapobservation + sensor202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 2≤10 km 10>10 km 5

17 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	34
Washington, US	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
Royal Saskatchewan Museumlocation not on record	9
East Lansing, US	8
North Carolina State University Insect Museumlocation not on record	7
New Haven, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Mississippi State, US	4
Oregon State Arthropod Collectionlocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Vernal, US	3
OSUClocation not on record	2
Toronto, CA	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

15 institutions · 118 of 118 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anania mysippusalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter32.3 °C

Max temp (day)21.5 °C

Min temp (night)12.0 °C

Precipitation105 mm/mo

Air humidity57.7 %

Moisture balance-35.5 mm/mo

Vapour deficit794 Pa

Wind speed3.80 m/s

Cloud cover52.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)