Anania terrealis

Treitschke, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records3 017

Data sources4

Biological traits0

DNA specimens38

eDNA detections0

Sources4 archives

Databases and archives Anania terrealis's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 017 records↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF3 017 records

DNA & barcodingBOLD38 specimens

Genome at a glanceGoaT≈541 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania terrealis has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

82Cmostly conserved

181Amostly conserved

184Gmostly conserved

205Cmostly conserved

217Amostly conserved

283Cmostly conserved

364Cmostly conserved

463Tmostly conserved

493Gvariable

508Amostly conserved

511Amostly conserved

544Cmostly conserved

550Amostly conserved

619Amostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes15

BINs2

Most divergent pair7.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania fuscalissame genus6.2%Anania flavasame genus6.4%Anania perlucidalissame genus6.7%Anania extricalissame genus7.0%Anania dionalissame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anania terrealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈540 778 685 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anania terrealis0.54 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type3 017 records

Wild obs. + sensor2 266

Museum / vouchered738

Other13

Range

Area of Occupancy AOO5 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 1 105≤1 km 589≤10 km 437>10 km 14

2 145 georeferenced · 121 without coordinates

Open the mapobservation + sensor2 266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 161≤1 km 168≤10 km 223>10 km 142

694 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence738

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	334
NHMOlocation not on record	96
DanishLepidopterologicalSocietylocation not on record	58
Zürich, CH	40
Tartu, EE	27
Salzburg, AT	22
SLU Artdatabankenlocation not on record	19
NTNU-VMlocation not on record	17
Kuopio, FI	14
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	13
Philadelphia, US	10
Provincia di Livornolocation not on record	7
Nijmegen, NL	7
Rovaniemi, FI	4
ZMAAlocation not on record	4
DABUHlocation not on record	2

16 institutions · 674 of 738 vouchered records shown · 64 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania terrealis

At a glance

Sources4 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 017 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Record type3 017 records