Anacampsis lupinella

Busck, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records76

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Anacampsis lupinella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anacampsis lupinella is a moth of the family Gelechiidae. It was described by August Busck in 1901. It is found in North America, where it has been recorded from Ontario, Florida, Illinois, Louisiana and Texas."Anacampsis Curtis, 1827" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved July 6, 2017.Moth Photographers Group The wingspan is about 14 mm. The forewings are purplish black, with a satin lustre and with numerous evenly distributed bluish white scales, only visible under a lens. There are several varieties. The forewings in some specimens are without any markings, while in others they have a distinct whitish-yellow spot at the beginning of the costal cilia and another similar dorsal spot opposite. In yet other specimens these spots are extended downwards and upwards relatively and meet each other, forming a narrow transverse fascia. The hindwings are black, with strong purple reflections. The larvae feed on Lupinus perennis.The Canadian Entomologist 33 (1): 14

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis lupinella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

82Tmostly conserved

214Gmostly conserved

352Gmostly conserved

530Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACCTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis timidellasame genus7.5%Anacampsis niveopulvellasame genus7.9%Anacampsis consonellasame genus8.1%Anacampsis agrimoniellasame genus8.2%Anacampsis temerellasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Wild obs. + sensor49

Museum / vouchered27

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 34≤1 km 7≤10 km 2>10 km 5

48 georeferenced · 1 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤1 km 13≤10 km 1>10 km 1

15 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	11
Mississippi State, US	3
New Haven, US	2
St. Paul, US	2
Georgia Museum of Natural Historylocation not on record	1
Washington, US	1
Cornell University Insect Collectionlocation not on record	1

7 institutions · 21 of 27 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Anacampsis lupinella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.5–22.8

Seasonal swing summer↔winter26.6 °C

Max temp (day)25.9 °C 25.2–25.9

Min temp (night)20.2 °C 20.2–20.4

Precipitation109 mm/mo 89.0–109

Air humidity58.5 % 58.5–58.9

Moisture balance-84.5 mm/mo -99.4–-84.5

Vapour deficit1,148 Pa 1,113–1,148

Wind speed5.00 m/s 5.00–5.40

Cloud cover36.3 % 36.3–37.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)