Ametastegia perla

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records285

Data sources6

Biological traits0

DNA specimens30

eDNA detections76

Sources6 archives

Databases and archives Ametastegia perla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF285 records

Environmental DNA3 datasets · 6 countries76 detections

DNA & barcodingBOLD30 specimens

01Narrative

Ametastegia perla is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia perla has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections76

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Tmostly conserved

3Tmostly conserved

4Amostly conserved

6Amostly conserved

8Tmostly conserved

11Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Tmostly conserved

17Gmostly conserved

18Gmostly conserved

19Amostly conserved

21Tmostly conserved

22Tmostly conserved

24Gmostly conserved

25Gmostly conserved

26Tmostly conserved

27Cmostly conserved

29Gmostly conserved

30Gmostly conserved

31Amostly conserved

32Amostly conserved

35Tmostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Gmostly conserved

41Cmostly conserved

42Tmostly conserved

43Tmostly conserved

45Cmostly conserved

46Amostly conserved

47Tmostly conserved

48Tmostly conserved

49Tmostly conserved

51Gmostly conserved

53Amostly conserved

55Amostly conserved

56Cmostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

62Cmostly conserved

63Gmostly conserved

65Amostly conserved

66Cmostly conserved

68Gmostly conserved

69Amostly conserved

70Amostly conserved

71Tmostly conserved

72Tmostly conserved

73Amostly conserved

74Gmostly conserved

75Gmostly conserved

76Tmostly conserved

77Amostly conserved

78Tmostly conserved

79Amostly conserved

80Cmostly conserved

81Cmostly conserved

83Gmostly conserved

84Gmostly conserved

85Tmostly conserved

86Tmostly conserved

87Cmostly conserved

91Amostly conserved

92Amostly conserved

93Tmostly conserved

96Gmostly conserved

284Cmostly conserved

490Amostly conserved

511Tmostly conserved

520Amostly conserved

562Amostly conserved

628Gmostly conserved

TTTATATTTTATTTTTGGATTTTGGTCAGGAATATTAGGTCTTTCATTTAGAATACTTATTCGAACAGAATTAGGTATACCTGGTTCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes5

BIN1

Most divergent pair2.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia persicasame genus7.3%Ametastegia pallipessame genus8.1%Ametastegia albipessame genus8.3%Ametastegia tenerasame genus8.4%Ametastegia glabratasame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type285 records

Wild obs. + sensor43

Museum / vouchered242

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 27≤1 km 5≤10 km 10

42 georeferenced · 1 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 136≤1 km 17≤10 km 20>10 km 3

176 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	64
BioFokuslocation not on record	17
Oulu, FI	15
Institute of Zoology Slovak Academy of Scienceslocation not on record	10
ZSMlocation not on record	8
MZLUlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	4
NEFlocation not on record	3
Stockholm, SE	3
SLU Artdatabankenlocation not on record	3
Philadelphia, US	2

11 institutions · 134 of 242 vouchered records shown · 108 without an institution code

09Environmental DNA76 detections

Where the DNA of Ametastegia perla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found76

Studies independent surveys3

Countries6

Verifiable raw sequence linked46

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 76 detections have coordinates

Open the map6 countries0

Forest edge (suburban)Mixed forest on sandy soilBog edge in alpine birch forest1. Forest & Woodland | 1.4. Temperate ForestLiten poll ved elven, torr viersumpskog rundt.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 12.4–16.2

Seasonal swing summer↔winter23.6 °C

Max temp (day)17.1 °C 15.1–19.5

Min temp (night)9.10 °C 7.90–12.9

Precipitation76.3 mm/mo 65.4–126

Air humidity58.6 % 55.7–62.3

Moisture balance-35.5 mm/mo -51.4–38.4

Vapour deficit675 Pa 563–761

Wind speed2.60 m/s 2.00–3.30

Cloud cover51.3 % 42.5–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)