Ametastegia glabrata

(Fallén, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records1 163

Data sources7

Biological traits0

DNA specimens51

eDNA detections199

Sources7 archives

Databases and archives Ametastegia glabrata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI199 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 163 records

Environmental DNA4 datasets · 12 countries199 detections

DNA & barcodingBOLD51 specimens

01Narrative

Ametastegia glabrata, known generally as the dock sawfly or dock false-worm, is a species of common sawfly in the family Tenthredinidae. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia glabrata has left across the world's sequence archives.

At a glance

DNA specimens51

BINs4

Marker genes1

eDNA detections199

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

28Amostly conserved

55Amostly conserved

61Cmostly conserved

64Amostly conserved

82Amostly conserved

103Cmostly conserved

166Amostly conserved

181Amostly conserved

193Gmostly conserved

217Cmostly conserved

232Tmostly conserved

268Gmostly conserved

277Cmostly conserved

280Tmostly conserved

334Tmostly conserved

340Cmostly conserved

367Gmostly conserved

382Cmostly conserved

406Gvariable

469Cmostly conserved

475Tmostly conserved

482Amostly conserved

511Cmostly conserved

559Amostly conserved

562Amostly conserved

578Cmostly conserved

613Cmostly conserved

TTTATATTTTATTTTTGGATTTTGATCAGGAATATTAGGATTATCATTTAGAATATTAATCCGAACAGAATTAGGAATACCAGGATCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes10

BINs4

Most divergent pair6.9%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia equisetisame genus5.7%Ametastegia apertasame genus8.1%Ametastegia pulchellasame genus8.6%Ametastegia perlasame genus8.6%Ametastegia albipessame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 163 records

Wild obs. + sensor599

Museum / vouchered564

Range

Area of Occupancy AOO2 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 295≤1 km 115≤10 km 129>10 km 2

541 georeferenced · 58 without coordinates

Open the mapobservation + sensor599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 197≤1 km 58≤10 km 125>10 km 3

383 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence564

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	105
NHMOlocation not on record	43
WIlocation not on record	26
BioFokuslocation not on record	25
OSUClocation not on record	22
Tilburg, NL	22
SLU Artdatabankenlocation not on record	20
Oulu, FI	19
Bonn, DE	16
Stockholm, SE	15
ZSMlocation not on record	14
neflocation not on record	12
NCMGlocation not on record	10
Institute of Zoology Slovak Academy of Scienceslocation not on record	5
Zürich, CH	5
Gothenburg, SE	4
Bavarian State Collection of Zoologylocation not on record	4
NEFlocation not on record	3
DFFW2018location not on record	3
University of Guelphlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Tromsø, NO	3
Chicago, US	3
Helsinki, FI	2
Natural History Museum Rotterdamlocation not on record	2
MZLUlocation not on record	2
Philadelphia, US	2
Vancouver, CA	2
University of Oululocation not on record	1
ZMAAlocation not on record	1
DFlocation not on record	1
Ugentlocation not on record	1

32 institutions · 399 of 564 vouchered records shown · 165 without an institution code

09Environmental DNA199 detections

Where the DNA of Ametastegia glabrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found199

Studies independent surveys4

Countries12

Verifiable raw sequence linked150

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 199 detections have coordinates

Open the map12 countries0

Agricultural field1. Forest & Woodland | 1.4. Temperate Forest14. Artificial - Terrestrial|14.1 Arable LandTemperate mixed forestMixed forest on sandy soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.1–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)19.7 °C 15.5–21.2

Min temp (night)12.6 °C 8.60–14.5

Precipitation78.3 mm/mo 56.7–95.3

Air humidity60.7 % 58.2–63.7

Moisture balance-35.6 mm/mo -66.1–35.3

Vapour deficit697 Pa 518–798

Wind speed3.60 m/s 2.40–5.00

Cloud cover49.6 % 38.5–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 199 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ametastegia glabrata

At a glance

Sources7 archives

At a glance

Record type1 163 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 163 records