Ametastegia equiseti

(Fallén, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records1 820

Data sources8

Biological traits0

DNA specimens109

eDNA detections205

Sources8 archives

Databases and archives Ametastegia equiseti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 820 records

Environmental DNA4 datasets · 18 countries205 detections

DNA & barcodingBOLD109 specimens

Genome at a glanceGoaT · NCBI≈292 Mbp

01Narrative

Ametastegia equiseti is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1808 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia equiseti has left across the world's sequence archives.

At a glance

DNA specimens109

BINs3

Marker genes1

eDNA detections205

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

29Gmostly conserved

56Gmostly conserved

98Amostly conserved

233Cmostly conserved

338Cmostly conserved

431Gmostly conserved

481Cvariable

560Tmostly conserved

CCTTATATTTTATTTTTGGATTTTGATCGGGAATATTAGGATTATCATTTAGAATGTTAATTCGTACAGAATTAGGAATACCTGGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes18

BINs3

Most divergent pair14.4%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia glabratasame genus5.7%Ametastegia apertasame genus6.6%Ametastegia pulchellasame genus7.9%Ametastegia tenerasame genus7.9%Ametastegia albipessame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ametastegia equiseti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈292 170 321 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ametastegia equiseti0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96% BUSCO

08Occurrence & distribution

Record type1 820 records

Wild obs. + sensor415

Museum / vouchered1 405

Range

Area of Occupancy AOO2 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 181≤1 km 78≤10 km 98>10 km 4

361 georeferenced · 54 without coordinates

Open the mapobservation + sensor415

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 956≤1 km 62≤10 km 183>10 km 7

1 208 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence1 405

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	247
Champaign, US	99
BioFokuslocation not on record	86
ZMAAlocation not on record	32
Tilburg, NL	18
Oulu, FI	18
Institute of Zoology Slovak Academy of Scienceslocation not on record	16
ZSMlocation not on record	16
Stockholm, SE	14
SLU Artdatabankenlocation not on record	14
Zürich, CH	12
MZLUlocation not on record	11
Tromsø, NO	9
Bavarian State Collection of Zoologylocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
Bonn, DE	6
OSUClocation not on record	5
neflocation not on record	4
Gothenburg, SE	3
NTNU-VMlocation not on record	3
University of Central Floridalocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
DFlocation not on record	2
Helsinki, FI	2
NEFlocation not on record	2
Ugentlocation not on record	2
Philadelphia, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
South Kensington, GB	1

29 institutions · 644 of 1 405 vouchered records shown · 761 without an institution code

09Environmental DNA205 detections

Where the DNA of Ametastegia equiseti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys4

Countries18

Verifiable raw sequence linked99

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map18 countries0

Hay meadowForestForest edge (suburban)Mixed forest on sandy soilFen edge1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 10.1–17.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)18.5 °C 13.2–21.2

Min temp (night)11.2 °C 5.40–13.5

Precipitation93.7 mm/mo 57.8–138

Air humidity59.8 % 57.2–63.3

Moisture balance-14.8 mm/mo -54.5–55.4

Vapour deficit682 Pa 504–798

Wind speed2.70 m/s 1.60–4.70

Cloud cover50.8 % 34.4–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 205 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ametastegia equiseti

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 820 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 820 records