Ametastegia albipes

(Thomson, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records344

Data sources6

Biological traits0

DNA specimens44

eDNA detections36

Sources6 archives

Databases and archives Ametastegia albipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility344 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF344 records

Environmental DNA3 datasets · 7 countries36 detections

DNA & barcodingBOLD44 specimens

01Narrative

Ametastegia albipes is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door C. G. Thomson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia albipes has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections36

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

8Tmostly conserved

205Amostly conserved

379Tmostly conserved

400Amostly conserved

496Cvariable

ATTATATTTTATTTTTGGATTTTGATCAGGAATATTAGGTCTTTCATTTAGAATATTAATTCGAACTGAATTAAGAATACCAGGATCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes5

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia apertasame genus7.2%Ametastegia tenerasame genus7.5%Ametastegia pallipessame genus8.1%Ametastegia equisetisame genus8.1%Ametastegia perlasame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type344 records

Wild obs. + sensor145

Museum / vouchered199

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 75≤1 km 38≤10 km 16

129 georeferenced · 16 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 81≤1 km 14≤10 km 12>10 km 2

109 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	40
BioFokuslocation not on record	24
Oulu, FI	18
ZSMlocation not on record	15
NHMOlocation not on record	14
Institute of Zoology Slovak Academy of Scienceslocation not on record	9
Bavarian State Collection of Zoologylocation not on record	9
Philadelphia, US	5
Tilburg, NL	5
Tromsø, NO	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Stockholm, SE	1
Bonn, DE	1
Natural History Museum, Londonlocation not on record	1
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1

16 institutions · 148 of 199 vouchered records shown · 51 without an institution code

09Environmental DNA36 detections

Where the DNA of Ametastegia albipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys3

Countries7

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map7 countries0

âMidtrabatterâ i motorcrossbane og omkri…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.00–18.1

Seasonal swing summer↔winter19.7 °C

Max temp (day)17.4 °C 12.8–22.6

Min temp (night)9.60 °C 4.40–13.6

Precipitation77.8 mm/mo 57.3–127

Air humidity58.7 % 57.0–61.8

Moisture balance-30.0 mm/mo -45.9–63.7

Vapour deficit670 Pa 480–869

Wind speed2.50 m/s 2.00–4.20

Cloud cover41.8 % 33.0–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)